Construct: ORF TRCN0000470494
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005256.1_s317c1
- Derived from:
- ccsbBroadEn_07109
- DNA Barcode:
- CAATTACAACATTCATCTATATAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TUBB2A (7280)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470494
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7280 | TUBB2A | tubulin beta 2A class IIa | NM_001069.3 | 99.9% | 100% | 564T>G |
| 2 | human | 347733 | TUBB2B | tubulin beta 2B class IIb | NM_178012.5 | 98.2% | 99.5% | (many diffs) |
| 3 | human | 10382 | TUBB4A | tubulin beta 4A class IVa | NM_001289129.1 | 90.1% | 95% | (many diffs) |
| 4 | human | 10382 | TUBB4A | tubulin beta 4A class IVa | NM_006087.4 | 90.1% | 95% | (many diffs) |
| 5 | human | 10381 | TUBB3 | tubulin beta 3 class III | NM_006086.4 | 87.8% | 91.1% | (many diffs) |
| 6 | human | 10383 | TUBB4B | tubulin beta 4B class IVb | NM_006088.6 | 87.2% | 96.4% | (many diffs) |
| 7 | human | 84617 | TUBB6 | tubulin beta 6 class V | NM_001303524.1 | 86.3% | 90.5% | (many diffs) |
| 8 | human | 84617 | TUBB6 | tubulin beta 6 class V | NM_032525.3 | 86.3% | 90.5% | (many diffs) |
| 9 | human | 203068 | TUBB | tubulin beta class I | NM_178014.4 | 84.6% | 95.2% | (many diffs) |
| 10 | human | 347688 | TUBB8 | tubulin beta 8 class VIII | NM_177987.2 | 82.4% | 88.1% | (many diffs) |
| 11 | human | 10382 | TUBB4A | tubulin beta 4A class IVa | NM_001289127.1 | 81.8% | 86.3% | (many diffs) |
| 12 | human | 260334 | TUBB8B | tubulin beta 8B | NM_001358689.1 | 81.6% | 86.3% | (many diffs) |
| 13 | human | 10382 | TUBB4A | tubulin beta 4A class IVa | NM_001289123.1 | 80.8% | 85.2% | (many diffs) |
| 14 | human | 84617 | TUBB6 | tubulin beta 6 class V | NM_001303526.2 | 80.6% | 83.1% | (many diffs) |
| 15 | human | 203068 | TUBB | tubulin beta class I | NM_001293212.2 | 80% | 88.1% | (many diffs) |
| 16 | human | 7280 | TUBB2A | tubulin beta 2A class IIa | NM_001310315.2 | 79.5% | 79.2% | (many diffs) |
| 17 | human | 203068 | TUBB | tubulin beta class I | NM_001293214.2 | 76.6% | 86.5% | (many diffs) |
| 18 | human | 10382 | TUBB4A | tubulin beta 4A class IVa | NM_001289130.1 | 76.4% | 80.2% | (many diffs) |
| 19 | human | 10382 | TUBB4A | tubulin beta 4A class IVa | NM_001289131.1 | 76.4% | 80.2% | (many diffs) |
| 20 | human | 10381 | TUBB3 | tubulin beta 3 class III | NM_001197181.2 | 74.6% | 76.6% | (many diffs) |
| 21 | human | 84617 | TUBB6 | tubulin beta 6 class V | NM_001303528.2 | 73.9% | 73.6% | (many diffs) |
| 22 | human | 84617 | TUBB6 | tubulin beta 6 class V | NM_001303527.2 | 73.3% | 76.6% | (many diffs) |
| 23 | human | 203068 | TUBB | tubulin beta class I | NM_001293215.2 | 71.1% | 80.2% | (many diffs) |
| 24 | human | 203068 | TUBB | tubulin beta class I | NM_001293216.2 | 71.1% | 80.2% | (many diffs) |
| 25 | human | 347688 | TUBB8 | tubulin beta 8 class VIII | XM_011519459.3 | 69.8% | 74.6% | (many diffs) |
| 26 | human | 260334 | TUBB8B | tubulin beta 8B | XM_024451145.1 | 69.3% | 73.5% | (many diffs) |
| 27 | human | 260334 | TUBB8B | tubulin beta 8B | XM_024451146.1 | 66.9% | 70.8% | (many diffs) |
| 28 | human | 347688 | TUBB8 | tubulin beta 8 class VIII | XM_017016192.2 | 62.5% | 66.3% | (many diffs) |
| 29 | human | 347688 | TUBB8 | tubulin beta 8 class VIII | XM_017016193.2 | 62.5% | 66.3% | (many diffs) |
| 30 | human | 260334 | TUBB8B | tubulin beta 8B | XM_024451147.1 | 61.5% | 65.4% | (many diffs) |
| 31 | human | 84617 | TUBB6 | tubulin beta 6 class V | NM_001303529.2 | 60.3% | 61.4% | (many diffs) |
| 32 | human | 84617 | TUBB6 | tubulin beta 6 class V | NM_001303530.2 | 60.3% | 61.4% | (many diffs) |
| 33 | human | 203068 | TUBB | tubulin beta class I | NM_001293213.2 | 46.4% | 51.2% | (many diffs) |
| 34 | human | 203068 | TUBB | tubulin beta class I | NR_120608.2 | 24.9% | (many diffs) | |
| 35 | mouse | 22151 | Tubb2a | tubulin, beta 2A class IIA | NM_009450.2 | 91.7% | 100% | (many diffs) |
| 36 | mouse | 73710 | Tubb2b | tubulin, beta 2B class IIB | NM_023716.2 | 91.3% | 99.5% | (many diffs) |
| 37 | mouse | 227613 | Tubb4b | tubulin, beta 4B class IVB | NM_146116.2 | 85.2% | 96.4% | (many diffs) |
| 38 | mouse | 22153 | Tubb4a | tubulin, beta 4A class IVA | NM_009451.3 | 84.6% | 95% | (many diffs) |
| 39 | mouse | 22154 | Tubb5 | tubulin, beta 5 class I | NM_011655.5 | 84.4% | 95.2% | (many diffs) |
| 40 | mouse | 22152 | Tubb3 | tubulin, beta 3 class III | NM_023279.2 | 83.9% | 90.8% | (many diffs) |
| 41 | mouse | 67951 | Tubb6 | tubulin, beta 6 class V | NM_026473.2 | 83.8% | 90.1% | (many diffs) |
| 42 | mouse | 627110 | Tubb2a-ps2 | tubulin, beta 2a, pseudogene 2 | NR_003964.2 | 26.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1401
- ORF length:
- 1335
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg cgagatcgtg cacatccagg cgggccagtg cggcaaccag atcggcgcca 121 agttttggga ggtcatcagc gatgagcatg ggatcgaccc cacaggcagt taccatggag 181 acagtgactt gcagctggag agaatcaacg tgtactacaa tgaggctgct ggtaacaaat 241 atgtacctcg ggccatcctg gtggatctgg agcctggcac catggactct gtcaggtctg 301 gacccttcgg ccagatcttc agaccagaca acttcgtgtt cggccagagt ggagccggga 361 ataactgggc caagggccac tacacagagg gagccgagct ggtcgactcg gtcctggatg 421 tggtgaggaa ggagtcagag agctgtgact gtctccaggg cttccagctg acccactctc 481 tggggggcgg cacggggtcc gggatgggca ccctgctcat cagcaagatc cgggaagagt 541 acccagaccg catcatgaac accttcagcg tcatgccctc acccaaggtg tcagacacgg 601 tggtggagcc ctacaacgcc accctctcgg tccaccagct ggtggaaaac acagatgaaa 661 cctactccat tgataacgag gccctgtatg acatctgctt ccgcaccctg aagctgacca 721 cccccaccta cggggacctc aaccacctgg tgtcggccac catgagcggg gtcaccacct 781 gcctgcgctt cccgggccag ctgaacgcag acctgcgcaa gctggcggtg aacatggtgc 841 ccttccctcg cctgcacttc ttcatgcccg gcttcgcgcc cctgaccagc cggggcagcc 901 agcagtaccg ggcgctcacg gtgcccgagc tcacccagca gatgttcgac tccaagaaca 961 tgatggccgc ctgcgacccg cgccacggcc gctacctgac ggtggctgcc aTCTTCCGGG 1021 GCCGCATGTC CATGAAGGAG GTGGACGAGC AGATGCTCAA CGTGCAGAAC AAGAACAGCA 1081 GCTACTTCGT GGAGTGGATC CCCAACAACG TGAAGACGGC CGTGTGCGAC ATCCCGCCCC 1141 GCGGCCTGAA GATGTCGGCC ACCTTCATCG GCAACAGCAC GGCCATCCAG GAGCTGTTCA 1201 AGCGCATCTC CGAGCAGTTC ACGGCCATGT TCCGGCGCAA GGCCTTCCTG CACTGGTACA 1261 CGGGCGAGGG CATGGACGAG ATGGAGTTCA CCGAGGCCGA GAGCAACATG AACGACCTGG 1321 TGTCCGAGTA CCAGCAGTAC CAGGACGCCA CGGCCGACGA ACAAGGGGAG TTCGAGGAGG 1381 AGGAGGGCGA GGACGAGGCT TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1441 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1501 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACAAT TACAACATTC 1561 ATCTATATAC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt