Transcript: Human NR_136583.2

Homo sapiens mitogen-activated protein kinase 8 (MAPK8), transcript variant 18, non-coding RNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
MAPK8 (5599)
Length:
5810
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136583.2
NBCI Gene record:
MAPK8 (5599)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001056 GCCCAGTAATATAGTAGTAAA pLKO.1 653 3UTR 100% 13.200 18.480 N MAPK8 n/a
2 TRCN0000001057 GTCTGGTATGATCCTTCTGAA pLKO.1 1157 3UTR 100% 4.950 6.930 N MAPK8 n/a
3 TRCN0000001055 GAGTCGGTTAGTCATTGATAG pLKO.1 1513 3UTR 100% 10.800 8.640 N MAPK8 n/a
4 TRCN0000352709 GAGTCGGTTAGTCATTGATAG pLKO_005 1513 3UTR 100% 10.800 8.640 N MAPK8 n/a
5 TRCN0000055115 GCAAATCTTTGCCAAGTGATT pLKO.1 531 3UTR 100% 4.950 3.960 N Mapk8 n/a
6 TRCN0000196820 GACCTAAATATGCTGGATATA pLKO.1 982 3UTR 100% 13.200 9.240 N MAPK8 n/a
7 TRCN0000194860 CAGTAAGGACTTACGTTGAAA pLKO.1 958 3UTR 100% 5.625 3.938 N MAPK8 n/a
8 TRCN0000342576 CAGTAAGGACTTACGTTGAAA pLKO_005 958 3UTR 100% 5.625 3.938 N MAPK8 n/a
9 TRCN0000010581 GACTCAGAACACAACAAACTT pLKO.1 1041 3UTR 100% 5.625 3.938 N MAPK8 n/a
10 TRCN0000342626 GACTCAGAACACAACAAACTT pLKO_005 1041 3UTR 100% 5.625 3.938 N MAPK8 n/a
11 TRCN0000055114 GCAGCTTATGATGCCATTCTT pLKO.1 318 3UTR 100% 5.625 3.938 N Mapk8 n/a
12 TRCN0000010580 CCACAGAAATCCCTAGAAGAA pLKO.1 474 3UTR 100% 4.950 3.465 N MAPK8 n/a
13 TRCN0000196304 GATTGGAGATTCTACATTCAC pLKO.1 236 3UTR 100% 4.950 3.465 N MAPK8 n/a
14 TRCN0000196371 GCAAGGGATTTGTTATCCAAA pLKO.1 1070 3UTR 100% 4.950 3.465 N MAPK8 n/a
15 TRCN0000196850 GTGTCTTCAATGTCAACAGAT pLKO.1 1390 3UTR 100% 4.950 3.465 N MAPK8 n/a
16 TRCN0000352648 GTGTCTTCAATGTCAACAGAT pLKO_005 1390 3UTR 100% 4.950 3.465 N MAPK8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01287 pDONR223 100% 21.5% None (many diffs) n/a
2 ccsbBroad304_01287 pLX_304 52.6% 21.5% V5 (many diffs) n/a
3 TRCN0000489338 CTCATGACGTTAAATTTCAGTTAA pLX_317 28.4% 19.7% V5 1_194del;1063_1064insAGCC;1343_5810delinsG n/a
4 TRCN0000489471 GTGAGACGATACCTATTGCCACGT pLX_317 32.6% 19.7% V5 (not translated due to prior stop codon) 1_194del;1063_1064insAGCC;1343_5810del n/a
5 TRCN0000492156 AACAGCCTCTTGTTACGAGGTCTG pLX_317 19.2% 19.7% V5 (not translated due to prior stop codon) 1_194del;1063_1064insAGCC;1343_5810del n/a
Download CSV