Construct: ORF TRCN0000492156
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020379.2_s317c1
- DNA Barcode:
- AACAGCCTCTTGTTACGAGGTCTG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MAPK8 (5599)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492156
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323302.2 | 100% | 100% | |
| 2 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323324.2 | 100% | 100% | |
| 3 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323326.2 | 100% | 100% | |
| 4 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323327.2 | 100% | 100% | |
| 5 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323321.2 | 97.4% | 97.9% | (many diffs) |
| 6 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323325.2 | 97.4% | 97.9% | (many diffs) |
| 7 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_139046.4 | 97.4% | 97.9% | (many diffs) |
| 8 | human | 5599 | MAPK8 | mitogen-activated protein k... | XM_024448080.1 | 97.4% | 97.9% | (many diffs) |
| 9 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323328.2 | 89.1% | 88.7% | 1136_1137insAGCAC;1148_1281del |
| 10 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323329.2 | 89.1% | 88.7% | 1136_1137insAGCAC;1148_1281del |
| 11 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323331.2 | 89.1% | 88.7% | 1136_1137insAGCAC;1148_1281del |
| 12 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_139049.4 | 89.1% | 88.7% | 1136_1137insAGCAC;1148_1281del |
| 13 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001278547.1 | 86.9% | 86.8% | (many diffs) |
| 14 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323322.2 | 86.9% | 86.8% | (many diffs) |
| 15 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323323.2 | 86.9% | 86.8% | (many diffs) |
| 16 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323330.2 | 86.9% | 86.8% | (many diffs) |
| 17 | human | 5599 | MAPK8 | mitogen-activated protein k... | XM_024448079.1 | 86.9% | 86.8% | (many diffs) |
| 18 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001278548.1 | 80.2% | 80.2% | 615_616ins228 |
| 19 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_001351625.2 | 79.7% | 92.4% | (many diffs) |
| 20 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008434.2 | 79.7% | 92.4% | (many diffs) |
| 21 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008435.2 | 79.7% | 92.4% | (many diffs) |
| 22 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008436.2 | 79.7% | 92.4% | (many diffs) |
| 23 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008437.2 | 79.7% | 92.4% | (many diffs) |
| 24 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_001363657.2 | 77.5% | 90.8% | (many diffs) |
| 25 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008441.2 | 73.8% | 86.4% | (many diffs) |
| 26 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_002753.5 | 72.6% | 84.1% | (many diffs) |
| 27 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_005263135.4 | 72.6% | 84.1% | (many diffs) |
| 28 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008429.2 | 72.6% | 84.1% | (many diffs) |
| 29 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008430.2 | 72.6% | 84.1% | (many diffs) |
| 30 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008432.2 | 72.6% | 84.1% | (many diffs) |
| 31 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454144.1 | 72.6% | 84.1% | (many diffs) |
| 32 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454145.1 | 72.6% | 84.1% | (many diffs) |
| 33 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454146.1 | 72.6% | 84.1% | (many diffs) |
| 34 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454147.1 | 72.6% | 84.1% | (many diffs) |
| 35 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323320.2 | 71.4% | 70.9% | 615_616ins228;908_909insAGCAC;920_1053del |
| 36 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_001351624.2 | 71.3% | 82.1% | (many diffs) |
| 37 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_138980.4 | 71.3% | 82.1% | (many diffs) |
| 38 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_006714268.3 | 71.3% | 82.1% | (many diffs) |
| 39 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_011532120.3 | 71.3% | 82.1% | (many diffs) |
| 40 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_011532121.3 | 71.3% | 82.1% | (many diffs) |
| 41 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008423.2 | 71.3% | 82.1% | (many diffs) |
| 42 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_006714269.3 | 70.6% | 82.7% | (many diffs) |
| 43 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008433.2 | 65.9% | 76.7% | (many diffs) |
| 44 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_138982.4 | 65.5% | 75.4% | (many diffs) |
| 45 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_005263129.3 | 65.5% | 75.4% | (many diffs) |
| 46 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_005263130.3 | 65.5% | 75.4% | (many diffs) |
| 47 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_011532117.3 | 65.5% | 75.4% | (many diffs) |
| 48 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_011532118.3 | 65.5% | 75.4% | (many diffs) |
| 49 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008420.2 | 65.5% | 75.4% | (many diffs) |
| 50 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454139.1 | 65.5% | 75.4% | (many diffs) |
| 51 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454140.1 | 65.5% | 75.4% | (many diffs) |
| 52 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454141.1 | 65.5% | 75.4% | (many diffs) |
| 53 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454142.1 | 65.5% | 75.4% | (many diffs) |
| 54 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454143.1 | 65.5% | 75.4% | (many diffs) |
| 55 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008451.2 | 64.5% | 74.2% | (many diffs) |
| 56 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_001318069.2 | 63.6% | 75.4% | (many diffs) |
| 57 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008422.2 | 60.5% | 70.4% | (many diffs) |
| 58 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008452.2 | 58.2% | 66.9% | (many diffs) |
| 59 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008445.2 | 57.6% | 65.7% | (many diffs) |
| 60 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008447.2 | 52% | 59.1% | (many diffs) |
| 61 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008448.2 | 52% | 59.1% | (many diffs) |
| 62 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008454.2 | 39% | 46.4% | (many diffs) |
| 63 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454149.1 | 39% | 46.4% | (many diffs) |
| 64 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008453.2 | 38.9% | 46.6% | (many diffs) |
| 65 | human | 5599 | MAPK8 | mitogen-activated protein k... | NR_136583.2 | 19.7% | 1_194del;1063_1064insAGCC;1343_5810del | |
| 66 | human | 5599 | MAPK8 | mitogen-activated protein k... | NR_136584.2 | 19.6% | (many diffs) | |
| 67 | human | 5599 | MAPK8 | mitogen-activated protein k... | NR_136585.2 | 19.3% | (many diffs) | |
| 68 | mouse | 26419 | Mapk8 | mitogen-activated protein k... | NM_016700.4 | 94% | 100% | (many diffs) |
| 69 | mouse | 26419 | Mapk8 | mitogen-activated protein k... | NM_001310452.1 | 91.6% | 97.9% | (many diffs) |
| 70 | mouse | 26419 | Mapk8 | mitogen-activated protein k... | XM_006519032.3 | 91.6% | 97.9% | (many diffs) |
| 71 | mouse | 26419 | Mapk8 | mitogen-activated protein k... | NM_001310454.1 | 83.9% | 88.7% | (many diffs) |
| 72 | mouse | 26419 | Mapk8 | mitogen-activated protein k... | NM_001310453.1 | 81.7% | 86.8% | (many diffs) |
| 73 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_017320890.2 | 77.8% | 92.4% | (many diffs) |
| 74 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_017320891.2 | 77.8% | 92.4% | (many diffs) |
| 75 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_030254519.1 | 75.9% | 91.4% | (many diffs) |
| 76 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_017320888.2 | 69.6% | 82.1% | (many diffs) |
| 77 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_006534950.4 | 69.1% | 83.1% | (many diffs) |
| 78 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_030254516.1 | 63.9% | 75.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1224
- ORF length:
- 1152
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgagcaga agcaagcgtg acaacaattt ttatagtgta gagattggag 121 attctacatt cacagtcctg aaacgatatc agaatttaaa acctataggc tcaggagctc 181 aaggaatagt atgcgcagct tatgatgcca ttcttgaaag aaatgttgca atcaagaagc 241 taagccgacc atttcagaat cagactcatg ccaagcgggc ctacagagag ctagttctta 301 tgaaatgtgt taatcacaaa aatataattg gccttttgaa tgttttcaca ccacagaaat 361 ccctagaaga atttcaagat gtttacatag tcatggagct catggatgca aatctttgcc 421 aagtgattca gatggagcta gatcatgaaa gaatgtccta ccttctctat cagatgctgt 481 gtggaatcaa gcaccttcat tctgctggaa ttattcatcg ggacttaaag cccagtaata 541 tagtagtaaa atctgattgc actttgaaga ttcttgactt cggtctggcc aggactgcag 601 gaacgagttt tatgatgacg ccttatgtag tgactcgcta ctacagagca cccgaggtca 661 tccttggcat gggctacaag gaaaacgtgg atttatggtc tgtggggtgc attatgggag 721 aaatggtttg ccacaaaatc ctctttccag gaagggacta tattgatcag tggaataaag 781 ttattgaaca gcttggaaca ccatgtcctg aattcatgaa gaaactgcaa ccaacagtaa 841 ggacttacgt tgaaaacaga cctaaatatg ctggatatag ctttgagaaa ctcttccctg 901 atgtcctttt cccagctgac tcagaacaca acaaacttaa agccagtcag gcaagggatt 961 tgttatccaa aatgctggta atagatgcat ctaaaaggat ctctgtagat GAAGCTCTCC 1021 AACACCCGTA CATCAATGTC TGGTATGATC CTTCTGAAGC AGAAGCTCCA CCACCAAAGA 1081 TCCCTGACAA GCAGTTAGAT GAAAGGGAAC ACACAATAGA AGAGTGGAAA GAATTGATAT 1141 ATAAGGAAGT TATGGACTTG GAGGAGAGAA CCAAGAATGG AGTTATACGG GGGCAGCCCT 1201 CTCCTTTAGC ACAGGTGCAG CAGTAGGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1261 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1321 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAAACAGCCT 1381 CTTGTTACGA GGTCTGACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1441 aagatt