Transcript: Mouse NM_009271.3

Mus musculus Rous sarcoma oncogene (Src), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Src (20779)
Length:
3887
CDS:
385..2010

Additional Resources:

NCBI RefSeq record:
NM_009271.3
NBCI Gene record:
Src (20779)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009271.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023598 CGAGCCGCCAATATCCTAGTA pLKO.1 1570 CDS 100% 4.950 6.930 N Src n/a
2 TRCN0000278661 CGAGCCGCCAATATCCTAGTA pLKO_005 1570 CDS 100% 4.950 6.930 N Src n/a
3 TRCN0000023594 GCAAGATCACTAGACGGGAAT pLKO.1 860 CDS 100% 4.050 5.670 N Src n/a
4 TRCN0000278597 GCAAGATCACTAGACGGGAAT pLKO_005 860 CDS 100% 4.050 5.670 N Src n/a
5 TRCN0000023596 GCGGCTGCAGATTGTCAATAA pLKO.1 708 CDS 100% 13.200 9.240 N Src n/a
6 TRCN0000297506 GCGGCTGCAGATTGTCAATAA pLKO_005 708 CDS 100% 13.200 9.240 N Src n/a
7 TRCN0000023597 GTGGCTTACTACTCCAAACAT pLKO.1 1087 CDS 100% 5.625 3.938 N Src n/a
8 TRCN0000278197 GTGGCTTACTACTCCAAACAT pLKO_005 1087 CDS 100% 5.625 3.938 N Src n/a
9 TRCN0000023595 CCTAAATGTGAAACACTACAA pLKO.1 996 CDS 100% 4.950 3.465 N Src n/a
10 TRCN0000278660 CCTAAATGTGAAACACTACAA pLKO_005 996 CDS 100% 4.950 3.465 N Src n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009271.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06992 pDONR223 99.9% 89% 97.7% None (many diffs) n/a
2 TRCN0000472109 TAACCCCTCCATGAGAGGGTGTGC pLX_317 30.5% 89% 97.7% V5 (many diffs) n/a
3 ccsbBroad304_06992 pLX_304 22.9% 76.7% 76.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_14845 pDONR223 0% 89% 97.7% None (many diffs) n/a
5 ccsbBroad304_14845 pLX_304 30.4% 89% 97.7% V5 (many diffs) n/a
6 TRCN0000470836 TCAGTGGTTTCCGGGGAGTTCTCG pLX_317 23.1% 89% 97.7% V5 (many diffs) n/a
7 TRCN0000488838 TAATATCATACATGAAACAATGTT pLX_317 16.6% 88.9% 97.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV