Transcript: Mouse NM_182809.2

Mus musculus neurotrophic tyrosine kinase, receptor, type 3 (Ntrk3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ntrk3 (18213)
Length:
3847
CDS:
56..1894

Additional Resources:

NCBI RefSeq record:
NM_182809.2
NBCI Gene record:
Ntrk3 (18213)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_182809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023515 CCGGTCCAAATTTGGAATGAA pLKO.1 1429 CDS 100% 5.625 7.875 N Ntrk3 n/a
2 TRCN0000023517 CCTGGAACATTGCATTGAGTT pLKO.1 1003 CDS 100% 4.950 6.930 N Ntrk3 n/a
3 TRCN0000361391 AGTGTAGTTTCTGGCGGATTT pLKO_005 81 CDS 100% 10.800 8.640 N Ntrk3 n/a
4 TRCN0000023514 GCAGCAAGACTGAGATCAATT pLKO.1 168 CDS 100% 13.200 9.240 N Ntrk3 n/a
5 TRCN0000379636 GCAGCAAGACTGAGATCAATT pLKO_005 168 CDS 100% 13.200 9.240 N NTRK3 n/a
6 TRCN0000361392 GGAACGCCAGCATCAACATTA pLKO_005 255 CDS 100% 13.200 9.240 N Ntrk3 n/a
7 TRCN0000002309 CACTACAACAATGGCAACTAT pLKO.1 1163 CDS 100% 5.625 4.500 N NTRK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06660 pDONR223 100% 92% 95.9% None (many diffs) n/a
2 ccsbBroad304_06660 pLX_304 0% 92% 95.9% V5 (many diffs) n/a
3 TRCN0000466614 AAAGTCTCTCTGTCTGGGCCCTCG pLX_317 19.7% 92% 95.9% V5 (many diffs) n/a
4 TRCN0000489478 CACGGAAAAAGCCGCCAGTGATGG pLX_317 16.1% 64.1% 62.5% V5 (many diffs) n/a
5 TRCN0000488840 TCGATGGTACGGTTACAATCTGAG pLX_317 13.2% 64.1% 62.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000491535 CCGAAACTCTCCGAGAGGCGTCAT pLX_317 12.8% 64.1% 62.4% V5 (many diffs) n/a
7 ccsbBroadEn_14722 pDONR223 0% 63.1% 61.5% None (many diffs) n/a
8 ccsbBroad304_14722 pLX_304 0% 63.1% 61.5% V5 (many diffs) n/a
9 TRCN0000472061 TCCTAGCAGCACTATGGTACACGG pLX_317 17.1% 63.1% 61.5% V5 (many diffs) n/a
Download CSV