Transcript: Mouse NM_010546.2

Mus musculus inhibitor of kappaB kinase beta (Ikbkb), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Ikbkb (16150)
Length:
4540
CDS:
133..2349

Additional Resources:

NCBI RefSeq record:
NM_010546.2
NBCI Gene record:
Ikbkb (16150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026913 GCATCTAGTAGAGCGGATGAT pLKO.1 1725 CDS 100% 4.950 6.930 N Ikbkb n/a
2 TRCN0000337472 GCATCTAGTAGAGCGGATGAT pLKO_005 1725 CDS 100% 4.950 6.930 N Ikbkb n/a
3 TRCN0000337474 CGAAGTGGACATCGTTGTTAG pLKO_005 849 CDS 100% 10.800 8.640 N Ikbkb n/a
4 TRCN0000337473 CTAACTACTCTTGCATCTAAC pLKO_005 2789 3UTR 100% 10.800 8.640 N Ikbkb n/a
5 TRCN0000026945 CGTTGTTAGTGAAGACTTGAA pLKO.1 861 CDS 100% 4.950 3.960 N Ikbkb n/a
6 TRCN0000026891 GCTCTTAGATACCTTCACGAA pLKO.1 526 CDS 100% 2.640 2.112 N Ikbkb n/a
7 TRCN0000350868 GATGAGTCTCCTCCGGAATAA pLKO_005 1497 CDS 100% 13.200 9.240 N Ikbkb n/a
8 TRCN0000337475 GGCAGTCTGTGCACGTCATTT pLKO_005 658 CDS 100% 13.200 9.240 N Ikbkb n/a
9 TRCN0000026894 CTTACCTGAATCAGACAAGAA pLKO.1 2223 CDS 100% 4.950 3.465 N Ikbkb n/a
10 TRCN0000026867 GCTGCACATTTGAATCTGTAA pLKO.1 3118 3UTR 100% 4.950 3.465 N Ikbkb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489474 CATCAGAGCTTCTTGCTCATCAGT pLX_317 17.5% 84.9% 90.7% V5 (many diffs) n/a
2 TRCN0000487969 TCACTCTGCATCGTATCCGTTGCT pLX_317 13.6% 84.9% 90.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_00841 pDONR223 100% 47.9% 48.9% None (many diffs) n/a
4 ccsbBroad304_00841 pLX_304 53.3% 47.9% 48.9% V5 (many diffs) n/a
5 TRCN0000477990 GGTACCTCTGAAAACAACGAACAT pLX_317 32.8% 47.9% 48.9% V5 (many diffs) n/a
Download CSV