Transcript: Human NM_001354.5

Homo sapiens aldo-keto reductase family 1 member C2 (AKR1C2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
AKR1C2 (1646)
Length:
3621
CDS:
414..1385

Additional Resources:

NCBI RefSeq record:
NM_001354.5
NBCI Gene record:
AKR1C2 (1646)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036554 GCCGTCAAATTGGCAATAGAA pLKO.1 522 CDS 100% 5.625 7.875 N AKR1C2 n/a
2 TRCN0000338771 AGCTCTAGAGGCCGTCAAATT pLKO_005 512 CDS 100% 13.200 10.560 N AKR1C2 n/a
3 TRCN0000036555 GATTCTGCACATGTTTACAAT pLKO.1 561 CDS 100% 5.625 3.938 N AKR1C2 n/a
4 TRCN0000338772 CTGCTTGGCGACTTCAGTAAG pLKO_005 1494 3UTR 100% 10.800 6.480 N AKR1C2 n/a
5 TRCN0000338769 ATGTTGACCTCTATCTTATTC pLKO_005 742 CDS 100% 13.200 6.600 Y AKR1C2 n/a
6 TRCN0000036545 GCGATATTTGACCCTTGATAT pLKO.1 1322 CDS 100% 13.200 6.600 Y AKR1C1 n/a
7 TRCN0000338702 TAAACAGAAATGTGCGATATT pLKO_005 1309 CDS 100% 13.200 6.600 Y AKR1C2 n/a
8 TRCN0000338701 ACATTGTTCTGGTTGCCTATA pLKO_005 1042 CDS 100% 10.800 5.400 Y AKR1C2 n/a
9 TRCN0000344684 CTAAACAGAAATGTGCGATAT pLKO_005 1308 CDS 100% 10.800 5.400 Y AKR1C1 n/a
10 TRCN0000344685 GACACAGAGGATGGCTCTATG pLKO_005 1436 3UTR 100% 10.800 5.400 Y AKR1C1 n/a
11 TRCN0000036556 CCAGGTGGAATGTCATCCTTA pLKO.1 980 CDS 100% 4.950 2.475 Y AKR1C2 n/a
12 TRCN0000036557 GCCTTGGAAAGGTCACTGAAA pLKO.1 705 CDS 100% 4.950 2.475 Y AKR1C2 n/a
13 TRCN0000036546 GCTGGATTTCTGCAAGTCAAA pLKO.1 1019 CDS 100% 4.950 2.475 Y AKR1C1 n/a
14 TRCN0000333053 GCTGGATTTCTGCAAGTCAAA pLKO_005 1019 CDS 100% 4.950 2.475 Y AKR1C1 n/a
15 TRCN0000036558 CCAGTTGACTTCAGAGGAGAT pLKO.1 1271 CDS 100% 4.050 2.025 Y AKR1C2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00429 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00429 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474088 GCCACAGGGGGTCCTCCCAGCAAC pLX_317 54.3% 100% 100% V5 n/a
4 ccsbBroadEn_15395 pDONR223 0% 99.7% 100% None 666T>C;783G>A n/a
5 ccsbBroad304_15395 pLX_304 0% 99.7% 100% V5 666T>C;783G>A n/a
6 TRCN0000469197 CGTTCACGTCATAGCGTTCCCGAA pLX_317 45.9% 99.7% 100% V5 666T>C;783G>A n/a
7 ccsbBroadEn_06088 pDONR223 100% 97.9% 97.8% None (many diffs) n/a
8 ccsbBroad304_06088 pLX_304 0% 97.9% 97.8% V5 (many diffs) n/a
9 TRCN0000479983 AGCTCTACATACTCGCGCACTCGG pLX_317 30.1% 96.7% 69% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000466588 CAATCAATAACCTCAGTACCACGA pLX_317 30.1% 96.7% 69% V5 (not translated due to prior stop codon) (many diffs) n/a
11 ccsbBroadEn_01979 pDONR223 100% 91.2% 86.9% None (many diffs) n/a
12 ccsbBroad304_01979 pLX_304 0% 91.2% 86.9% V5 (many diffs) n/a
13 TRCN0000470055 CTAACGCAGCTGGGGGCTCATTCC pLX_317 31.7% 91.2% 86.9% V5 (many diffs) n/a
14 ccsbBroadEn_07279 pDONR223 100% 91.1% 86.9% None (many diffs) n/a
15 ccsbBroad304_07279 pLX_304 0% 91.1% 86.9% V5 (many diffs) n/a
16 TRCN0000472656 TGTTTCCACATAATGTTAGATTCA pLX_317 50.9% 91.1% 86.9% V5 (many diffs) n/a
17 ccsbBroadEn_05989 pDONR223 100% 88.4% 81.7% None (many diffs) n/a
18 ccsbBroad304_05989 pLX_304 0% 88.4% 81.7% V5 (many diffs) n/a
19 TRCN0000470334 TGTTCAACCACATTCTAATTAGTC pLX_317 39.5% 88.4% 81.7% V5 (many diffs) n/a
Download CSV