Transcript: Mouse NM_001286417.1

Mus musculus RNA binding protein, fox-1 homolog (C. elegans) 2 (Rbfox2), transcript variant 7, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Rbfox2 (93686)
Length:
4587
CDS:
257..1306

Additional Resources:

NCBI RefSeq record:
NM_001286417.1
NBCI Gene record:
Rbfox2 (93686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286417.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074544 CGGGTTCGTAACTTTCGAGAA pLKO.1 715 CDS 100% 4.050 5.670 N RBFOX2 n/a
2 TRCN0000311693 CGGGTTCGTAACTTTCGAGAA pLKO_005 715 CDS 100% 4.050 5.670 N RBFOX2 n/a
3 TRCN0000102343 CGACTACATGTCTCTAATATT pLKO.1 593 CDS 100% 15.000 10.500 N Rbfox2 n/a
4 TRCN0000102344 GCTGTGTATGGTCCTGAGTTA pLKO.1 890 CDS 100% 4.950 3.465 N Rbfox2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286417.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02790 pDONR223 100% 85.4% 79% None (many diffs) n/a
2 ccsbBroad304_02790 pLX_304 0% 85.4% 79% V5 (many diffs) n/a
3 ccsbBroadEn_11745 pDONR223 100% 81.8% 75.9% None (many diffs) n/a
4 ccsbBroad304_11745 pLX_304 0% 81.8% 75.9% V5 (many diffs) n/a
5 TRCN0000478244 AAGGTTCGACCCGCACGGCTGATA pLX_317 24.7% 81.8% 75.9% V5 (many diffs) n/a
Download CSV