Transcript: Human NM_001278547.1

Homo sapiens mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
MAPK8 (5599)
Length:
5854
CDS:
233..1516

Additional Resources:

NCBI RefSeq record:
NM_001278547.1
NBCI Gene record:
MAPK8 (5599)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278547.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001056 GCCCAGTAATATAGTAGTAAA pLKO.1 691 CDS 100% 13.200 18.480 N MAPK8 n/a
2 TRCN0000001057 GTCTGGTATGATCCTTCTGAA pLKO.1 1199 CDS 100% 4.950 6.930 N MAPK8 n/a
3 TRCN0000001055 GAGTCGGTTAGTCATTGATAG pLKO.1 1550 3UTR 100% 10.800 8.640 N MAPK8 n/a
4 TRCN0000352709 GAGTCGGTTAGTCATTGATAG pLKO_005 1550 3UTR 100% 10.800 8.640 N MAPK8 n/a
5 TRCN0000055115 GCAAATCTTTGCCAAGTGATT pLKO.1 569 CDS 100% 4.950 3.960 N Mapk8 n/a
6 TRCN0000196820 GACCTAAATATGCTGGATATA pLKO.1 1020 CDS 100% 13.200 9.240 N MAPK8 n/a
7 TRCN0000194860 CAGTAAGGACTTACGTTGAAA pLKO.1 996 CDS 100% 5.625 3.938 N MAPK8 n/a
8 TRCN0000342576 CAGTAAGGACTTACGTTGAAA pLKO_005 996 CDS 100% 5.625 3.938 N MAPK8 n/a
9 TRCN0000010581 GACTCAGAACACAACAAACTT pLKO.1 1079 CDS 100% 5.625 3.938 N MAPK8 n/a
10 TRCN0000342626 GACTCAGAACACAACAAACTT pLKO_005 1079 CDS 100% 5.625 3.938 N MAPK8 n/a
11 TRCN0000055114 GCAGCTTATGATGCCATTCTT pLKO.1 356 CDS 100% 5.625 3.938 N Mapk8 n/a
12 TRCN0000010580 CCACAGAAATCCCTAGAAGAA pLKO.1 512 CDS 100% 4.950 3.465 N MAPK8 n/a
13 TRCN0000196304 GATTGGAGATTCTACATTCAC pLKO.1 274 CDS 100% 4.950 3.465 N MAPK8 n/a
14 TRCN0000196371 GCAAGGGATTTGTTATCCAAA pLKO.1 1112 CDS 100% 4.950 3.465 N MAPK8 n/a
15 TRCN0000196850 GTGTCTTCAATGTCAACAGAT pLKO.1 1427 CDS 100% 4.950 3.465 N MAPK8 n/a
16 TRCN0000352648 GTGTCTTCAATGTCAACAGAT pLKO_005 1427 CDS 100% 4.950 3.465 N MAPK8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278547.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01287 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01287 pLX_304 52.6% 100% 100% V5 n/a
3 TRCN0000489338 CTCATGACGTTAAATTTCAGTTAA pLX_317 28.4% 86.9% 86.8% V5 (many diffs) n/a
4 TRCN0000489471 GTGAGACGATACCTATTGCCACGT pLX_317 32.6% 86.9% 86.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000492156 AACAGCCTCTTGTTACGAGGTCTG pLX_317 19.2% 86.9% 86.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_14803 pDONR223 61.1% 59.7% 1% None (many diffs) n/a
7 ccsbBroad304_14803 pLX_304 34.9% 59.7% 1% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000473545 CGAAATGCGCTGAAAGCACCGTTT pLX_317 22.7% 59.7% 1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV