Transcript: Human XM_011523075.1

PREDICTED: Homo sapiens kinesin family member C3 (KIFC3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIFC3 (3801)
Length:
3533
CDS:
218..2866

Additional Resources:

NCBI RefSeq record:
XM_011523075.1
NBCI Gene record:
KIFC3 (3801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523075.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271532 ACGACATCAACAAGGTGTTTG pLKO_005 2223 CDS 100% 10.800 15.120 N KIFC3 n/a
2 TRCN0000116466 CAACGACTACAATGGGCTCAA pLKO.1 1501 CDS 100% 4.050 5.670 N KIFC3 n/a
3 TRCN0000116462 TGCAAATTGCATGGGCGGAAA pLKO.1 3039 3UTR 100% 4.050 5.670 N KIFC3 n/a
4 TRCN0000271531 AGCGCTGCGGAGATCTACAAT pLKO_005 2081 CDS 100% 5.625 4.500 N KIFC3 n/a
5 TRCN0000271533 ACCTGAAGGAGAAGCTCATTA pLKO_005 687 CDS 100% 13.200 9.240 N KIFC3 n/a
6 TRCN0000271534 TGAAGGCTGTGCACGAGAATC pLKO_005 1425 CDS 100% 10.800 7.560 N KIFC3 n/a
7 TRCN0000116463 CTGCGTAAGAAGTGCCACAAT pLKO.1 1655 CDS 100% 4.950 3.465 N KIFC3 n/a
8 TRCN0000116465 GACGCTCTATTCCCTCAAGTT pLKO.1 2626 CDS 100% 4.950 3.465 N KIFC3 n/a
9 TRCN0000271541 TTCAGAAGGAAACGGTGTCTC pLKO_005 3001 3UTR 100% 4.050 2.835 N KIFC3 n/a
10 TRCN0000116464 TCTTGCATTGATGGCTTCAAT pLKO.1 1907 CDS 100% 0.563 0.394 N KIFC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523075.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488029 AACGCATGTCCGTGTACATCGGTC pLX_317 14.8% 77.8% 77.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14686 pDONR223 97% 77.7% 77.5% None (many diffs) n/a
3 ccsbBroad304_14686 pLX_304 0% 77.7% 77.5% V5 (many diffs) n/a
4 TRCN0000481469 CGTTTGCCGTTTGTCCTGATCTTA pLX_317 25.8% 74.9% 74.9% V5 (many diffs) n/a
Download CSV