Transcript: Human XR_001751183.1

PREDICTED: Homo sapiens adaptor related protein complex 4 subunit epsilon 1 (AP4E1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AP4E1 (23431)
Length:
6568
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751183.1
NBCI Gene record:
AP4E1 (23431)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382113 GTAGATCAAGCTATAACTAAA pLKO_005 2328 3UTR 100% 13.200 18.480 N AP4E1 n/a
2 TRCN0000147403 GTTCTACTCTTCCTGACTATT pLKO.1 3272 3UTR 100% 13.200 18.480 N AP4E1 n/a
3 TRCN0000148874 CAGAGCACTAACCTAGTAGAA pLKO.1 534 3UTR 100% 4.950 6.930 N AP4E1 n/a
4 TRCN0000276394 CAGAGCACTAACCTAGTAGAA pLKO_005 534 3UTR 100% 4.950 6.930 N AP4E1 n/a
5 TRCN0000149437 GCTGAGAAATATGCTCCTGAT pLKO.1 1416 3UTR 100% 4.050 5.670 N AP4E1 n/a
6 TRCN0000379843 GATGCTTCCTTTGGCTATATT pLKO_005 384 3UTR 100% 15.000 12.000 N AP4E1 n/a
7 TRCN0000382453 GAAACTAAGACTCCATATTAT pLKO_005 3138 3UTR 100% 15.000 10.500 N AP4E1 n/a
8 TRCN0000276393 TCTACTCTTCCTGACTATTTA pLKO_005 3274 3UTR 100% 15.000 10.500 N AP4E1 n/a
9 TRCN0000276455 AGAGTATGTCATCGTCAATTT pLKO_005 1373 3UTR 100% 13.200 9.240 N AP4E1 n/a
10 TRCN0000148615 CCTTACGAAGAGCTGAGTTAA pLKO.1 1012 3UTR 100% 13.200 9.240 N AP4E1 n/a
11 TRCN0000148077 GCTAAGCTCTACAAGTTACTT pLKO.1 1710 3UTR 100% 5.625 3.938 N AP4E1 n/a
12 TRCN0000276457 GCTAAGCTCTACAAGTTACTT pLKO_005 1710 3UTR 100% 5.625 3.938 N AP4E1 n/a
13 TRCN0000148614 CCCTAACCTTTAACTCAGGAT pLKO.1 3502 3UTR 100% 2.640 1.848 N AP4E1 n/a
14 TRCN0000276392 CCCTAACCTTTAACTCAGGAT pLKO_005 3502 3UTR 100% 2.640 1.848 N AP4E1 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5811 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5811 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02765 pDONR223 100% 47.6% None 1_107del;3009_3010ins191;3328_6568del n/a
2 ccsbBroad304_02765 pLX_304 0% 47.6% V5 1_107del;3009_3010ins191;3328_6568del n/a
3 TRCN0000467195 CCGACTGTACATGTTCGCCGCGTG pLX_317 10.8% 47.6% V5 1_107del;3009_3010ins191;3328_6568del n/a
4 ccsbBroadEn_13781 pDONR223 100% 3.7% None (many diffs) n/a
5 ccsbBroad304_13781 pLX_304 0% 3.7% V5 (many diffs) n/a
6 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 3.7% V5 (many diffs) n/a
7 ccsbBroadEn_10261 pDONR223 100% .9% None (many diffs) n/a
8 ccsbBroad304_10261 pLX_304 0% .9% V5 (many diffs) n/a
9 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% .9% V5 (many diffs) n/a
Download CSV