Transcript: Mouse XM_006505176.3

PREDICTED: Mus musculus ankyrin repeat, SAM and basic leucine zipper domain containing 1 (Asz1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Asz1 (74068)
Length:
1381
CDS:
119..1099

Additional Resources:

NCBI RefSeq record:
XM_006505176.3
NBCI Gene record:
Asz1 (74068)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505176.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436474 TTCATCGGCAAGCTAACTTTG pLKO_005 1067 CDS 100% 10.800 15.120 N Asz1 n/a
2 TRCN0000084921 CCCAGGATGAGAATGGTTATA pLKO.1 201 CDS 100% 13.200 10.560 N Asz1 n/a
3 TRCN0000415794 GCTTGAACTGGGAGCTAATAA pLKO_005 274 CDS 100% 15.000 10.500 N Asz1 n/a
4 TRCN0000084919 GCCCAGGATGAGAATGGTTAT pLKO.1 200 CDS 100% 10.800 7.560 N Asz1 n/a
5 TRCN0000084918 CCTGTACTCCAAAGGAACAAT pLKO.1 1196 3UTR 100% 5.625 3.938 N Asz1 n/a
6 TRCN0000084922 CGGACCCAAATACTGCTTGTA pLKO.1 29 5UTR 100% 4.950 3.465 N Asz1 n/a
7 TRCN0000084920 GCAGAATATCATTACCGAGTT pLKO.1 793 CDS 100% 4.050 2.835 N Asz1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505176.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04908 pDONR223 100% 59.2% 59.1% None (many diffs) n/a
2 ccsbBroad304_04908 pLX_304 0% 59.2% 59.1% V5 (many diffs) n/a
3 TRCN0000473096 CGTTCCGGTTGCCCGATATTTGGA pLX_317 35.7% 59.2% 59.1% V5 (many diffs) n/a
4 ccsbBroadEn_10548 pDONR223 100% 44.9% 44.4% None (many diffs) n/a
5 ccsbBroad304_10548 pLX_304 0% 44.9% 44.4% V5 (many diffs) n/a
6 TRCN0000491826 AACGGTTTTCCCCCTAGATCGGAA pLX_317 11.4% 44.9% 44.4% V5 (many diffs) n/a
Download CSV