Transcript: Mouse XM_017317588.1

PREDICTED: Mus musculus bromodomain containing 4 (Brd4), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Brd4 (57261)
Length:
6034
CDS:
795..4556

Additional Resources:

NCBI RefSeq record:
XM_017317588.1
NBCI Gene record:
Brd4 (57261)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088480 GCGGCAGCTAAGTCTAGATAT pLKO.1 2201 CDS 100% 13.200 10.560 N Brd4 n/a
2 TRCN0000311977 GCGGCAGCTAAGTCTAGATAT pLKO_005 2201 CDS 100% 13.200 10.560 N Brd4 n/a
3 TRCN0000088482 GCCATCTACACTACGAGAGTT pLKO.1 2336 CDS 100% 4.950 3.960 N Brd4 n/a
4 TRCN0000380416 ATGAGCACAATCAAGTCTAAA pLKO_005 1554 CDS 100% 13.200 9.240 N BRD4 n/a
5 TRCN0000349783 TGAACCTCCCTGATTACTATA pLKO_005 538 5UTR 100% 13.200 9.240 N Brd4 n/a
6 TRCN0000382028 TGAACCTCCCTGATTACTATA pLKO_005 538 5UTR 100% 13.200 9.240 N BRD4 n/a
7 TRCN0000199674 GCATCCTCAAGGAGATGTTTG pLKO.1 1432 CDS 100% 10.800 7.560 N BRD4 n/a
8 TRCN0000088479 CCTCCCTGATTACTATAAGAT pLKO.1 542 5UTR 100% 5.625 3.938 N Brd4 n/a
9 TRCN0000199972 CCAACCAAAGTCAGTTCCTTC pLKO.1 5257 3UTR 100% 4.050 2.835 N BRD4 n/a
10 TRCN0000088481 GATGTGTTTGAAATGCGCTTT pLKO.1 1698 CDS 100% 4.050 2.835 N Brd4 n/a
11 TRCN0000311976 GATGTGTTTGAAATGCGCTTT pLKO_005 1698 CDS 100% 4.050 2.835 N Brd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11738 pDONR223 100% 39.4% 38.7% None (many diffs) n/a
2 ccsbBroad304_11738 pLX_304 0% 39.4% 38.7% V5 (many diffs) n/a
3 TRCN0000477053 TCTAGTTTCTTACTTTTTGCCGAC pLX_317 9.5% 39.4% 38.7% V5 (many diffs) n/a
4 TRCN0000487806 ATCGTTGCGGCTGACGACGATGAT pLX_317 12.2% 39.4% 38.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_15013 pDONR223 71.9% 36% 7.6% None (many diffs) n/a
6 ccsbBroad304_15013 pLX_304 26.9% 36% 7.6% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000491254 CTCAGTAGTCTGCAGGTTTCGGTT pLX_317 11.4% 36% 7.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV