Transcript: Human NM_001317897.2

Homo sapiens small integral membrane protein 14 (SMIM14), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
SMIM14 (201895)
Length:
6263
CDS:
174..473

Additional Resources:

NCBI RefSeq record:
NM_001317897.2
NBCI Gene record:
SMIM14 (201895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139831 CTTGGTAGCCTGGATGGTTAT pLKO.1 341 CDS 100% 10.800 7.560 N SMIM14 n/a
2 TRCN0000140949 CGAACGAAGATGACCAGAGTA pLKO.1 521 3UTR 100% 4.950 3.465 N SMIM14 n/a
3 TRCN0000144810 GAATGTGTTTGCTCTCATGAA pLKO.1 201 CDS 100% 4.950 3.465 N SMIM14 n/a
4 TRCN0000145240 GAGAAGACTGATCAATCTGTT pLKO.1 230 CDS 100% 4.950 3.465 N SMIM14 n/a
5 TRCN0000145399 GCAGATGATTTACAGTCCATT pLKO.1 1179 3UTR 100% 4.950 3.465 N SMIM14 n/a
6 TRCN0000122873 GCTCTCATGAACATGCAATGA pLKO.1 211 CDS 100% 4.950 3.465 N SMIM14 n/a
7 TRCN0000139766 CCTCTGGTGATAATGGCATCA pLKO.1 307 CDS 100% 4.050 2.835 N SMIM14 n/a
8 TRCN0000144167 CTCATGAACATGCAATGAGAA pLKO.1 214 CDS 100% 0.495 0.347 N SMIM14 n/a
9 TRCN0000142869 CAGTCCTCATAATGGACAAGA pLKO.1 428 CDS 100% 4.950 2.970 N SMIM14 n/a
10 TRCN0000140192 GAAAGCCAACCAGTCCTCATA pLKO.1 418 CDS 100% 4.950 2.970 N SMIM14 n/a
11 TRCN0000142752 CCTCATAATGGACAAGATCCA pLKO.1 432 CDS 100% 2.640 1.584 N SMIM14 n/a
12 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 3641 3UTR 100% 10.800 5.400 Y MRPS16 n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1408 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1408 3UTR 100% 4.950 2.475 Y C19orf31 n/a
15 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1486 3UTR 100% 4.950 2.475 Y ORAI2 n/a
16 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2037 3UTR 100% 4.950 2.475 Y ERAP2 n/a
17 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1447 3UTR 100% 4.050 2.025 Y P3H4 n/a
18 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1447 3UTR 100% 4.050 2.025 Y ORAI2 n/a
19 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1447 3UTR 100% 4.050 2.025 Y P3H4 n/a
20 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 2105 3UTR 100% 13.200 6.600 Y IQCC n/a
21 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2038 3UTR 100% 13.200 6.600 Y LIAS n/a
22 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 3641 3UTR 100% 10.800 5.400 Y CD3EAP n/a
23 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1483 3UTR 100% 4.950 2.475 Y LOC339059 n/a
24 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1406 3UTR 100% 4.950 2.475 Y ERN2 n/a
25 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1406 3UTR 100% 4.950 2.475 Y P3H4 n/a
26 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1406 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05200 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05200 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474064 GTGATTTTAAACTCCCGATAAACT pLX_317 100% 100% 100% V5 n/a
Download CSV