Transcript: Human NM_001256497.3

Homo sapiens CYP3A7-CYP3A51P readthrough (CYP3A7-CYP3A51P), mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
CYP3A7-CYP3A51P (100861540)
Length:
2260
CDS:
104..1711

Additional Resources:

NCBI RefSeq record:
NM_001256497.3
NBCI Gene record:
CYP3A7-CYP3A51P (100861540)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256497.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064019 GCTTTGGAGGACTTCTTCTAA pLKO.1 1536 CDS 100% 5.625 2.813 Y CYP3A7 n/a
2 TRCN0000064022 CCTCCCTGAAAGGTTCAGTAA pLKO.1 1345 CDS 100% 4.950 2.475 Y CYP3A7 n/a
3 TRCN0000064018 CGTAAGGGCTATTGGACGTTT pLKO.1 263 CDS 100% 4.950 2.475 Y CYP3A7 n/a
4 TRCN0000064020 CCTTACATATACACACCCTTT pLKO.1 1388 CDS 100% 4.050 2.025 Y CYP3A7 n/a
5 TRCN0000064226 CCCACCTATGATACTGTGCTA pLKO.1 1136 CDS 100% 2.640 1.320 Y CYP3A4 n/a
6 TRCN0000064021 GAAATGCTTTGTCCTTCCGTA pLKO.1 246 CDS 100% 2.640 1.320 Y CYP3A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256497.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06073 pDONR223 100% 93.8% 93.2% None (many diffs) n/a
2 ccsbBroad304_06073 pLX_304 0% 93.8% 93.2% V5 (many diffs) n/a
3 TRCN0000470575 CTAAAATCTCGCTGGTGGCATAGC pLX_317 30.2% 93.8% 93.2% V5 (many diffs) n/a
4 ccsbBroadEn_00411 pDONR223 100% 88.6% 82.4% None (many diffs) n/a
5 ccsbBroad304_00411 pLX_304 0% 88.6% 82.4% V5 (many diffs) n/a
6 TRCN0000477588 ATCTATTATTTATGACGGCGACCT pLX_317 35.4% 88.6% 82.4% V5 (many diffs) n/a
7 ccsbBroadEn_00412 pDONR223 100% 82.9% 76.4% None (many diffs) n/a
8 ccsbBroad304_00412 pLX_304 0% 82.9% 76.4% V5 (many diffs) n/a
9 TRCN0000468230 ATCAACTGGCCTGCGCCACCCCTT pLX_317 31.3% 82.9% 76.4% V5 (many diffs) n/a
Download CSV