Transcript: Human NM_013398.4

Homo sapiens zinc finger protein 224 (ZNF224), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ZNF224 (7767)
Length:
4011
CDS:
286..2409

Additional Resources:

NCBI RefSeq record:
NM_013398.4
NBCI Gene record:
ZNF224 (7767)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013398.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013070 CCGATGTGATACGTGTGATAA pLKO.1 1233 CDS 100% 13.200 10.560 N ZNF224 n/a
2 TRCN0000232178 TCCCAGGGCAATGGATATAAA pLKO_005 727 CDS 100% 15.000 10.500 N ZNF224 n/a
3 TRCN0000013068 GCAGAGAAACACCTCTCAAAT pLKO.1 2141 CDS 100% 13.200 9.240 N ZNF224 n/a
4 TRCN0000232180 TTGTAGGCGAGATCTTTATAC pLKO_005 1347 CDS 100% 13.200 9.240 N ZNF224 n/a
5 TRCN0000232179 CGATGTGATACGTGTGATAAG pLKO_005 1234 CDS 100% 10.800 7.560 N ZNF224 n/a
6 TRCN0000013069 CAATGGATATAAACCATCCTT pLKO.1 735 CDS 100% 3.000 2.100 N ZNF224 n/a
7 TRCN0000232177 GTTCTCCAAAGAAGGTGATTT pLKO_005 654 CDS 100% 13.200 7.920 N ZNF224 n/a
8 TRCN0000013071 GTGGGAAGAGATTTACTCAAA pLKO.1 1751 CDS 100% 4.950 2.970 N ZNF224 n/a
9 TRCN0000239543 ACAGGAGAGAAACCTTATAAA pLKO_005 1048 CDS 100% 15.000 7.500 Y Gm13212 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013398.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07177 pDONR223 100% 99.8% 99.7% None (many diffs) n/a
2 ccsbBroad304_07177 pLX_304 0% 99.8% 99.7% V5 (many diffs) n/a
3 TRCN0000469087 TAGTTGACACCGCGGTGTCCATGT pLX_317 21.4% 99.8% 99.7% V5 (many diffs) n/a
4 ccsbBroadEn_01821 pDONR223 100% 79.1% 71.4% None (many diffs) n/a
5 ccsbBroad304_01821 pLX_304 0% 79.1% 71.4% V5 (many diffs) n/a
6 TRCN0000468268 AGACCACTGATCAAGATCTATTTA pLX_317 18.1% 79.1% 71.4% V5 (many diffs) n/a
7 ccsbBroadEn_07162 pDONR223 100% 71.6% 63.5% None (many diffs) n/a
8 ccsbBroad304_07162 pLX_304 0% 71.6% 63.5% V5 (many diffs) n/a
9 TRCN0000474103 CGTATCCGGTAAACAACTGTACCC pLX_317 13.6% 71.6% 63.5% V5 (many diffs) n/a
10 ccsbBroadEn_07167 pDONR223 100% 64.4% 57.5% None (many diffs) n/a
11 ccsbBroad304_07167 pLX_304 0% 64.4% 57.5% V5 (many diffs) n/a
12 TRCN0000472100 CATTCGAGTACGACGCCCGCGCAT pLX_317 28.8% 64.4% 57.5% V5 (many diffs) n/a
Download CSV