Transcript: Human XR_937537.3

PREDICTED: Homo sapiens junctional adhesion molecule 2 (JAM2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
JAM2 (58494)
Length:
4194
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_937537.3
NBCI Gene record:
JAM2 (58494)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_937537.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435912 ACCGTTGTTACACAAGTTATT pLKO_005 1661 3UTR 100% 13.200 18.480 N JAM2 n/a
2 TRCN0000425979 ACTCTGCTTTGTCCGACATTT pLKO_005 1695 3UTR 100% 13.200 9.240 N JAM2 n/a
3 TRCN0000412465 TAGAGTACCAAGAGGCTATTT pLKO_005 654 3UTR 100% 13.200 9.240 N JAM2 n/a
4 TRCN0000422911 TCATCTAAAGCCACGACAATG pLKO_005 1569 3UTR 100% 10.800 7.560 N JAM2 n/a
5 TRCN0000057847 GCTCAGAGGAAAGGCTACTTT pLKO.1 1313 3UTR 100% 5.625 3.938 N JAM2 n/a
6 TRCN0000057845 GCTCATACACAATGAATACAA pLKO.1 1095 3UTR 100% 5.625 3.938 N JAM2 n/a
7 TRCN0000057846 GAAGACTGTTTCCTCCAGATT pLKO.1 694 3UTR 100% 4.950 3.465 N JAM2 n/a
8 TRCN0000057843 GCTCCTGAATACACATGGTTT pLKO.1 1019 3UTR 100% 4.950 3.465 N JAM2 n/a
9 TRCN0000057844 GCTGAGATGATAGATTTCAAT pLKO.1 791 3UTR 100% 5.625 3.375 N JAM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_937537.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03863 pDONR223 100% 21.3% None 1_532del;1354_1555del;1629_4194del n/a
2 ccsbBroad304_03863 pLX_304 0% 21.3% V5 1_532del;1354_1555del;1629_4194del n/a
3 TRCN0000492227 TCGTCATTTCGGGTGCGGCCTGCA pLX_317 49% 21.3% V5 1_532del;1354_1555del;1629_4194del n/a
4 ccsbBroadEn_11616 pDONR223 100% 4.1% None (many diffs) n/a
5 ccsbBroad304_11616 pLX_304 0% 4.1% V5 (many diffs) n/a
6 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 4.1% V5 (many diffs) n/a
Download CSV