Transcript: Human NM_001371916.1

Homo sapiens mediator of cell motility 1 (MEMO1), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-07-26
Taxon:
Homo sapiens (human)
Gene:
MEMO1 (51072)
Length:
7970
CDS:
88..912

Additional Resources:

NCBI RefSeq record:
NM_001371916.1
NBCI Gene record:
MEMO1 (51072)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250449 AGACCTGCTAGAGCCATTATT pLKO_005 205 CDS 100% 15.000 21.000 N Memo1 n/a
2 TRCN0000258053 TATCTAGCGGATCCTAGTAAT pLKO_005 544 CDS 100% 13.200 18.480 N Memo1 n/a
3 TRCN0000122895 CCTCTGTATGACCTTCGTATT pLKO.1 313 CDS 100% 10.800 15.120 N MEMO1 n/a
4 TRCN0000344125 CCTCTGTATGACCTTCGTATT pLKO_005 313 CDS 100% 10.800 15.120 N MEMO1 n/a
5 TRCN0000122898 GCAAGACAGTTCAGTGAGTTA pLKO.1 864 CDS 100% 4.950 6.930 N MEMO1 n/a
6 TRCN0000122896 TGGAGCTCTGAGTGAGTCAAA pLKO.1 492 CDS 100% 4.950 6.930 N MEMO1 n/a
7 TRCN0000352982 TGGAGCTCTGAGTGAGTCAAA pLKO_005 492 CDS 100% 4.950 6.930 N MEMO1 n/a
8 TRCN0000215789 CATTTGCCTTATACAGCTAAA pLKO.1 424 CDS 100% 10.800 8.640 N Memo1 n/a
9 TRCN0000250450 CATTTGCCTTATACAGCTAAA pLKO_005 424 CDS 100% 10.800 8.640 N Memo1 n/a
10 TRCN0000128951 GCACTTTCCAGTGTGGATATA pLKO.1 283 CDS 100% 13.200 9.240 N MEMO1 n/a
11 TRCN0000353044 GCACTTTCCAGTGTGGATATA pLKO_005 283 CDS 100% 13.200 9.240 N MEMO1 n/a
12 TRCN0000130024 GAAAGCCATAAGGATGAGTTT pLKO.1 451 CDS 100% 4.950 3.465 N MEMO1 n/a
13 TRCN0000130305 GTCAAAGGTTCCGTTACAGTT pLKO.1 599 CDS 100% 4.950 3.465 N MEMO1 n/a
14 TRCN0000344179 GTCAAAGGTTCCGTTACAGTT pLKO_005 599 CDS 100% 4.950 3.465 N MEMO1 n/a
15 TRCN0000127599 CACAGCTAGAAGGTTGGCTTT pLKO.1 164 CDS 100% 4.050 2.835 N MEMO1 n/a
16 TRCN0000122894 CCTTCCTTAATTTCAACTCAT pLKO.1 1065 3UTR 100% 4.950 2.970 N MEMO1 n/a
17 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3173 3UTR 100% 4.950 2.475 Y ERAP2 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3174 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15819 pDONR223 0% 92.2% 92.2% None 142_143ins69 n/a
2 ccsbBroad304_15819 pLX_304 0% 92.2% 92.2% V5 142_143ins69 n/a
3 TRCN0000470853 TAAACTCTGATTATTAATTGGTAT pLX_317 46.9% 92.2% 92.2% V5 142_143ins69 n/a
4 ccsbBroadEn_08210 pDONR223 100% 92.1% 91.9% None 69G>T;142_143ins69 n/a
5 ccsbBroad304_08210 pLX_304 0% 92.1% 91.9% V5 69G>T;142_143ins69 n/a
6 TRCN0000468812 CTTGATACTTGGCAAGCCATTGTG pLX_317 46.2% 92.1% 91.9% V5 69G>T;142_143ins69 n/a
Download CSV