Transcript: Human NM_018287.7

Homo sapiens Rho GTPase activating protein 12 (ARHGAP12), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ARHGAP12 (94134)
Length:
5060
CDS:
260..2800

Additional Resources:

NCBI RefSeq record:
NM_018287.7
NBCI Gene record:
ARHGAP12 (94134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018287.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047266 GCACCATTGTATTGGACACTA pLKO.1 1527 CDS 100% 4.950 6.930 N ARHGAP12 n/a
2 TRCN0000291761 GCACCATTGTATTGGACACTA pLKO_005 1527 CDS 100% 4.950 6.930 N ARHGAP12 n/a
3 TRCN0000047267 CCTGACCCATAATAACGGAAA pLKO.1 712 CDS 100% 4.050 5.670 N ARHGAP12 n/a
4 TRCN0000291762 CCTGACCCATAATAACGGAAA pLKO_005 712 CDS 100% 4.050 5.670 N ARHGAP12 n/a
5 TRCN0000375710 AGTCATATACACTGGATAATT pLKO_005 3087 3UTR 100% 15.000 10.500 N Arhgap12 n/a
6 TRCN0000047264 CGCTGCTGTTAAGGACCTAAT pLKO.1 2545 CDS 100% 10.800 7.560 N ARHGAP12 n/a
7 TRCN0000291833 CGCTGCTGTTAAGGACCTAAT pLKO_005 2545 CDS 100% 10.800 7.560 N ARHGAP12 n/a
8 TRCN0000047265 CCCAGGAACAATCTTGTGATT pLKO.1 840 CDS 100% 4.950 3.465 N ARHGAP12 n/a
9 TRCN0000047263 CCAGTCATATACACTGGATAA pLKO.1 3085 3UTR 100% 1.080 0.756 N ARHGAP12 n/a
10 TRCN0000291831 CCAGTCATATACACTGGATAA pLKO_005 3085 3UTR 100% 1.080 0.756 N ARHGAP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018287.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13006 pDONR223 100% 99.4% 99.4% None 1372_1386del n/a
2 ccsbBroad304_13006 pLX_304 0% 99.4% 99.4% V5 1372_1386del n/a
3 TRCN0000477925 ACATATATAATGGTCGTCTGCCTC pLX_317 16.6% 99.3% 99.2% V5 1372_1386del;2533G>C n/a
4 ccsbBroadEn_13005 pDONR223 100% 94.4% 94.4% None 947_1087del n/a
5 ccsbBroad304_13005 pLX_304 0% 94.4% 94.4% V5 947_1087del n/a
Download CSV