Transcript: Human XM_011510655.3

PREDICTED: Homo sapiens myosin IIIB (MYO3B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYO3B (140469)
Length:
3976
CDS:
5..3976

Additional Resources:

NCBI RefSeq record:
XM_011510655.3
NBCI Gene record:
MYO3B (140469)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002404 CCTATGATGCTTGGACTTGAA pLKO.1 65 CDS 100% 4.950 6.930 N MYO3B n/a
2 TRCN0000002405 CCGTACACAGACTTCAAGCAA pLKO.1 3478 CDS 100% 3.000 4.200 N MYO3B n/a
3 TRCN0000110532 CCATGTACTATAACCAGTTAA pLKO.1 3768 CDS 100% 13.200 9.240 N Myo3b n/a
4 TRCN0000194885 CCATGTACTATAACCAGTTAA pLKO.1 3768 CDS 100% 13.200 9.240 N MYO3B n/a
5 TRCN0000002401 GTTCTGGATGAGGATACAATT pLKO.1 1088 CDS 100% 13.200 9.240 N MYO3B n/a
6 TRCN0000195076 CCTTCCAGAATCTAAGCATAT pLKO.1 1185 CDS 100% 10.800 7.560 N MYO3B n/a
7 TRCN0000196783 GAAGATAATCTACGATGCAAA pLKO.1 2471 CDS 100% 4.950 3.465 N MYO3B n/a
8 TRCN0000002402 GCAGCTATTTCCTCTCAACAT pLKO.1 1883 CDS 100% 4.950 3.465 N MYO3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15253 pDONR223 36.9% 97.1% 82.8% None (many diffs) n/a
2 ccsbBroad304_15253 pLX_304 0% 97.1% 82.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469340 CCCGGACATTGGAGAATAGCCTAG pLX_317 8.6% 97.1% 82.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV