Transcript: Human XM_005246669.2

PREDICTED: Homo sapiens STE20 related adaptor beta (STRADB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STRADB (55437)
Length:
2022
CDS:
301..1158

Additional Resources:

NCBI RefSeq record:
XM_005246669.2
NBCI Gene record:
STRADB (55437)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146838 CAGATAGTTCAACCCTCTCA pXPR_003 CGG 508 59% 7 0.7455 STRADB STRADB 75495
2 BRDN0001146450 GAGCTCATAGTGAGAAACGT pXPR_003 TGG 163 19% 4 0.7083 STRADB STRADB 75494
3 BRDN0001148940 CTTGCACGGCATACTCCCAC pXPR_003 AGG 242 28% 5 0.4941 STRADB STRADB 75496
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246669.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195094 CTAATCTAGCTAGTGTCATTT pLKO.1 1564 3UTR 100% 13.200 18.480 N STRADB n/a
2 TRCN0000007074 GCCGTGATTCTATCCCACTTT pLKO.1 619 CDS 100% 4.950 6.930 N STRADB n/a
3 TRCN0000418437 AGGAACACTGGTAACTATAAA pLKO_005 546 CDS 100% 15.000 10.500 N STRADB n/a
4 TRCN0000007072 GCACTGGAGAATCTATTATTT pLKO.1 1461 3UTR 100% 15.000 10.500 N STRADB n/a
5 TRCN0000196884 GAAACCAGTATCCATCAATAC pLKO.1 370 CDS 100% 10.800 7.560 N STRADB n/a
6 TRCN0000194701 CAGAGTACTATGACAAGGAAA pLKO.1 1532 3UTR 100% 4.950 3.465 N STRADB n/a
7 TRCN0000007076 GCTTTGGGTTATTTCTCCATT pLKO.1 693 CDS 100% 4.950 3.465 N STRADB n/a
8 TRCN0000196530 GAACACAAGTTGAATCACTCA pLKO.1 332 CDS 100% 2.640 1.848 N STRADB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246669.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488001 GGGCTCAGCGAAGGCACAAATGGC pLX_317 25.8% 68.1% 66.2% V5 (not translated due to prior stop codon) 756C>T;823_824ins206;855_856ins193 n/a
2 TRCN0000488545 CTCATACCTGATAGCGCAGGAGCC pLX_317 25.7% 68% 66.1% V5 756C>T;823_824ins206;855_856ins194 n/a
3 ccsbBroadEn_08534 pDONR223 100% 68% 66.2% None (many diffs) n/a
4 ccsbBroad304_08534 pLX_304 0% 68% 66.2% V5 (many diffs) n/a
5 TRCN0000480011 CGACCGGTTCTTATGCTTCATGCA pLX_317 32.2% 68% 66.2% V5 (many diffs) n/a
6 ccsbBroadEn_15321 pDONR223 100% 59.1% 47.9% None (many diffs) n/a
7 TRCN0000466482 CTGGCTGCCAGCGCATTTACCTTT pLX_317 20.8% 59.1% 47.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_15091 pDONR223 40% 22.6% 41.7% None (many diffs) n/a
9 ccsbBroad304_15091 pLX_304 0% 22.6% 41.7% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000467627 TTGCAGACCCTGAAATGCCAATCA pLX_317 12.4% 22.6% 41.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV