Transcript: Human XM_005248833.2

PREDICTED: Homo sapiens butyrophilin subfamily 3 member A1 (BTN3A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTN3A1 (11119)
Length:
3381
CDS:
337..1857

Additional Resources:

NCBI RefSeq record:
XM_005248833.2
NBCI Gene record:
BTN3A1 (11119)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248833.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163145 GCTGTGGATGGATCGCATATT pLKO.1 1741 CDS 100% 13.200 18.480 N BTN3A1 n/a
2 TRCN0000160935 GTGGATGGATCGCATATTCAT pLKO.1 1744 CDS 100% 5.625 7.875 N BTN3A1 n/a
3 TRCN0000158875 GCAACCAATCACAACCATAAA pLKO.1 2019 3UTR 100% 13.200 9.240 N BTN3A1 n/a
4 TRCN0000158933 GCACAATGAAGCAAGAACAAA pLKO.1 1223 CDS 100% 5.625 3.938 N BTN3A1 n/a
5 TRCN0000160841 GAGAGAGACATTCAGCCTATA pLKO.1 1283 CDS 100% 10.800 6.480 N BTN3A1 n/a
6 TRCN0000160127 CAGTAAGAATGTGCAGAGAAA pLKO.1 1551 CDS 100% 4.950 2.970 N BTN3A1 n/a
7 TRCN0000161633 GCAGTAAGAATGTGCAGAGAA pLKO.1 1550 CDS 100% 4.950 2.970 N BTN3A1 n/a
8 TRCN0000164463 CCTTCTGCTCAACTTTCGTGT pLKO.1 363 CDS 100% 2.640 1.584 N BTN3A1 n/a
9 TRCN0000123204 CCCTAGAGATTCTCTGTGATA pLKO.1 2795 3UTR 100% 4.950 2.475 Y BTN3A3 n/a
10 TRCN0000162141 CCCTAGAGATTCTCTGTGATA pLKO.1 2795 3UTR 100% 4.950 2.475 Y BTN3A1 n/a
11 TRCN0000061426 GAACGTGTATGCAGATGGAAA pLKO.1 564 CDS 100% 4.950 2.475 Y BTN3A2 n/a
12 TRCN0000161171 GCCTTCCTTCAATCAAGGTTT pLKO.1 2758 3UTR 100% 4.950 2.475 Y BTN3A1 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3106 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3106 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248833.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489565 GTACGATGCCCACACCGAACAAGC pLX_317 22.8% 98.6% 98.4% V5 (not translated due to prior stop codon) 916_917ins21 n/a
2 TRCN0000489719 CATACACTGCGTGGTTCGTCGGTA pLX_317 25.4% 98.5% 98.2% V5 916_917ins21;1518_1519insG n/a
3 ccsbBroadEn_07755 pDONR223 100% 98.5% 98.2% None 916_917ins21;1345C>A n/a
4 ccsbBroad304_07755 pLX_304 0% 98.5% 98.2% V5 916_917ins21;1345C>A n/a
5 ccsbBroadEn_02417 pDONR223 100% 78.5% 73.9% None (many diffs) n/a
6 ccsbBroad304_02417 pLX_304 0% 78.5% 73.9% V5 (many diffs) n/a
7 TRCN0000468589 ACTAGCCCAGTTCCAATTTATGAG pLX_317 22.1% 78.5% 73.9% V5 (many diffs) n/a
8 TRCN0000489137 TTACTCAGCCTTAGGATTTATCGA pLX_317 21.3% 78.5% 73.9% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489559 ACATCAGTGTCGACACGCCAGATT pLX_317 21.9% 78.4% 73.8% V5 (many diffs) n/a
10 ccsbBroadEn_10209 pDONR223 100% 59.6% 52.6% None (many diffs) n/a
11 ccsbBroad304_10209 pLX_304 0% 59.6% 52.6% V5 (many diffs) n/a
12 TRCN0000480174 CACTCTCACGGGGATCCTTCGGCT pLX_317 36.8% 59.6% 52.6% V5 (many diffs) n/a
Download CSV