Transcript: Human XM_005251453.3

PREDICTED: Homo sapiens aquaporin 7 (AQP7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AQP7 (364)
Length:
3334
CDS:
436..1464

Additional Resources:

NCBI RefSeq record:
XM_005251453.3
NBCI Gene record:
AQP7 (364)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251453.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059693 GCTGTGACCTTTGCTAACTGT pLKO.1 721 CDS 100% 3.000 2.100 N AQP7 n/a
2 TRCN0000416490 GGAACAGAGGCGCTGGTGATA pLKO_005 1033 CDS 100% 1.650 1.155 N AQP7 n/a
3 TRCN0000415705 GGAGGAAGTTTCCGGTCTATG pLKO_005 761 CDS 100% 10.800 6.480 N AQP7 n/a
4 TRCN0000434757 TGGAGGATTCTGTGGCGTATG pLKO_005 1295 CDS 100% 6.000 3.600 N AQP7 n/a
5 TRCN0000418146 CCTATCTAGGTGGCATCATCT pLKO_005 1229 CDS 100% 4.950 2.970 N AQP7 n/a
6 TRCN0000059695 CCTTGGCATGAACACAGGATA pLKO.1 1083 CDS 100% 4.950 2.970 N AQP7 n/a
7 TRCN0000059694 GCCGAGTTCATGAGCACATAT pLKO.1 550 CDS 100% 13.200 6.600 Y AQP7 n/a
8 TRCN0000059697 CGTATGAAGACCACGGGATAA pLKO.1 1310 CDS 100% 10.800 5.400 Y AQP7 n/a
9 TRCN0000059696 CCTTGGTGTCAACTTGGGTTT pLKO.1 636 CDS 100% 4.050 2.025 Y AQP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251453.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10684 pDONR223 100% 63.1% 56.9% None 1_171del;742_800del;879_1026del n/a
2 ccsbBroad304_10684 pLX_304 0% 63.1% 56.9% V5 1_171del;742_800del;879_1026del n/a
3 TRCN0000480437 ATTTCATTATTATATTTCTAGTTA pLX_317 63% 63.1% 56.9% V5 1_171del;742_800del;879_1026del n/a
4 ccsbBroadEn_13660 pDONR223 100% 23.7% 15.9% None (many diffs) n/a
5 ccsbBroad304_13660 pLX_304 0% 23.7% 15.9% V5 (many diffs) n/a
6 TRCN0000469925 TGAGAACACATCCGGTCGACACGT pLX_317 100% 23.7% 15.9% V5 (many diffs) n/a
Download CSV