Transcript: Human XM_005255158.4

PREDICTED: Homo sapiens eukaryotic elongation factor 2 lysine methyltransferase (EEF2KMT), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EEF2KMT (196483)
Length:
2454
CDS:
428..1120

Additional Resources:

NCBI RefSeq record:
XM_005255158.4
NBCI Gene record:
EEF2KMT (196483)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255158.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230961 CTGGCAGGCAGTAATCGTTCT pLKO_005 143 5UTR 100% 4.050 5.670 N FAM86B2 n/a
2 TRCN0000172925 GCAGACATCACTGCCAAGTTA pLKO.1 755 CDS 100% 5.625 3.375 N EEF2KMT n/a
3 TRCN0000172964 GCAGAAACTGTTTCCCTACGA pLKO.1 1060 CDS 100% 2.640 1.584 N EEF2KMT n/a
4 TRCN0000444970 CTGAGCTGCTGCGGGATATTT pLKO_005 258 5UTR 100% 15.000 7.500 Y EEF2KMT n/a
5 TRCN0000430453 AGAGCTTAGAAGCAAAGTTAA pLKO_005 222 5UTR 100% 13.200 6.600 Y EEF2KMT n/a
6 TRCN0000172901 GCCAGCAGTTCTGGTTCTTAA pLKO.1 1309 3UTR 100% 13.200 6.600 Y EEF2KMT n/a
7 TRCN0000447299 TCTGAGCTGCTGCGGGATATT pLKO_005 257 5UTR 100% 13.200 6.600 Y FAM86C1 n/a
8 TRCN0000427069 TTTATATGGGAAAGCGGATAA pLKO_005 1179 3UTR 100% 10.800 5.400 Y FAM86C1 n/a
9 TRCN0000168498 GCAGAGCTTAGAAGCAAAGTT pLKO.1 220 5UTR 100% 5.625 2.813 Y FAM86C1 n/a
10 TRCN0000172312 CGAGGGAATGTCCTTCTCAAT pLKO.1 719 CDS 100% 4.950 2.475 Y EEF2KMT n/a
11 TRCN0000128827 GCTTTCTCTCAGAACTCATCA pLKO.1 342 5UTR 100% 4.950 2.475 Y FAM86B1 n/a
12 TRCN0000129161 GTGCTTTCTCTCAGAACTCAT pLKO.1 340 5UTR 100% 4.950 2.475 Y FAM86B1 n/a
13 TRCN0000168609 GATGTTGTCATTGCAGCAGAT pLKO.1 851 CDS 100% 4.050 2.025 Y EEF2KMT n/a
14 TRCN0000172453 CGAACTCTTGCTGCAGAGTTT pLKO.1 80 5UTR 100% 0.495 0.248 Y FAM86C1 n/a
15 TRCN0000168044 CCAACGGGATTGTGAGAATTA pLKO.1 1136 3UTR 100% 13.200 6.600 Y FAM86C1 n/a
16 TRCN0000190450 GTTGTCATTGCAGCAGATGTA pLKO.1 854 CDS 100% 4.950 2.475 Y Eef2kmt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255158.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488399 TACCTGCGCGCCTAACAATCATGA pLX_317 37.3% 69.5% 69.3% V5 (not translated due to prior stop codon) 0_1ins300;68C>G n/a
2 ccsbBroadEn_09791 pDONR223 100% 69.4% 69.3% None 0_1ins300;483G>C;514C>G n/a
3 ccsbBroad304_09791 pLX_304 0% 69.4% 69.3% V5 0_1ins300;483G>C;514C>G n/a
4 TRCN0000466174 GGAGAGATGACCTTCCATCATCTG pLX_317 21.3% 69.4% 69.3% V5 0_1ins300;483G>C;514C>G n/a
5 TRCN0000488297 ACTAGACGAAAAATGAGGCATGGA pLX_317 30.4% 69.4% 69.3% V5 (not translated due to prior stop codon) 0_1ins300;483G>C;514C>G n/a
6 TRCN0000491961 CCGTTCATGATGGCGTAAGTACGC pLX_317 33.3% 59.3% 59% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV