Transcript: Mouse XM_006504987.3

PREDICTED: Mus musculus glutamate receptor, metabotropic 8 (Grm8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grm8 (14823)
Length:
4548
CDS:
1243..3969

Additional Resources:

NCBI RefSeq record:
XM_006504987.3
NBCI Gene record:
Grm8 (14823)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504987.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219400 TGAACGCTGCGAGGGTTATAA pLKO.1 2856 CDS 100% 15.000 21.000 N Grm8 n/a
2 TRCN0000219404 CAAACCGTATCCACCGAATAT pLKO.1 3251 CDS 100% 13.200 18.480 N Grm8 n/a
3 TRCN0000363183 CAAACCGTATCCACCGAATAT pLKO_005 3251 CDS 100% 13.200 18.480 N GRM8 n/a
4 TRCN0000219403 TGACAACACCAGGTATGATTT pLKO.1 1794 CDS 100% 13.200 18.480 N Grm8 n/a
5 TRCN0000219407 TTACATCAGGGCCGTGAATTT pLKO.1 2574 CDS 100% 13.200 18.480 N Grm8 n/a
6 TRCN0000220782 CCGCTATAATGACACACCAAT pLKO.1 3060 CDS 100% 4.950 6.930 N Grm8 n/a
7 TRCN0000220783 CGTGCATCATTTGGTTAGCTT pLKO.1 3611 CDS 100% 3.000 4.200 N Grm8 n/a
8 TRCN0000220780 CGCAGTGATTATGTTTGCCAA pLKO.1 2070 CDS 100% 2.640 3.696 N Grm8 n/a
9 TRCN0000219401 TATGCAATCGACCAGATTAAT pLKO.1 1483 CDS 100% 15.000 12.000 N Grm8 n/a
10 TRCN0000220781 CGCTACGATATCTTCCAATAT pLKO.1 2650 CDS 100% 13.200 10.560 N Grm8 n/a
11 TRCN0000363196 GTGACCTTTGTCCGCTATAAT pLKO_005 3049 CDS 100% 15.000 10.500 N GRM8 n/a
12 TRCN0000219408 AGACATGCAGTGGGCTAATAG pLKO.1 2742 CDS 100% 13.200 9.240 N Grm8 n/a
13 TRCN0000219402 CCATCATGGTGGCTAACATTT pLKO.1 1718 CDS 100% 13.200 9.240 N Grm8 n/a
14 TRCN0000219406 CTTGCCAATAATCGAAGAAAT pLKO.1 2290 CDS 100% 13.200 9.240 N Grm8 n/a
15 TRCN0000219405 GATGACATCAGGAGGATATTG pLKO.1 2095 CDS 100% 13.200 9.240 N Grm8 n/a
16 TRCN0000363156 GATGACATCAGGAGGATATTG pLKO_005 2095 CDS 100% 13.200 9.240 N GRM8 n/a
17 TRCN0000219409 CTTGTACTGTTTATGCCATTA pLKO.1 3527 CDS 100% 10.800 7.560 N Grm8 n/a
18 TRCN0000220779 CGACAAGATTTCTGGTGTCAT pLKO.1 1674 CDS 100% 4.950 3.465 N Grm8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504987.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489666 CTGTACCGCGCATAGGTGACCTTG pLX_317 13% 91.9% 98% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487954 AGCGCTCGGAAATCGTTCTGTCGG pLX_317 12.3% 91.8% 97.9% V5 (many diffs) n/a
3 TRCN0000492137 GATTACATGGCCTACAAACTATCG pLX_317 12.5% 90.9% 96.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489225 CGCAGCTCTTTACGAAAGTTGGCA pLX_317 12.4% 90.8% 95.8% V5 (many diffs) n/a
5 ccsbBroadEn_06327 pDONR223 100% 90.8% 96.6% None (many diffs) n/a
6 ccsbBroad304_06327 pLX_304 0% 90.8% 96.6% V5 (many diffs) n/a
7 TRCN0000477307 TTAGTATTTATGGTTTTCTTGATC pLX_317 16.8% 90.8% 96.6% V5 (many diffs) n/a
Download CSV