Transcript: Mouse XM_006535611.3

PREDICTED: Mus musculus protein kinase, AMP-activated, gamma 2 non-catalytic subunit (Prkag2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prkag2 (108099)
Length:
3733
CDS:
918..2621

Additional Resources:

NCBI RefSeq record:
XM_006535611.3
NBCI Gene record:
Prkag2 (108099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535611.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078841 CTCACGATTACAGATTTCATA pLKO.1 1863 CDS 100% 5.625 7.875 N Prkag2 n/a
2 TRCN0000078839 GCTCACGATTACAGATTTCAT pLKO.1 1862 CDS 100% 5.625 7.875 N Prkag2 n/a
3 TRCN0000078842 CGATGCTGTATACTCGTTGAT pLKO.1 2024 CDS 100% 4.950 6.930 N Prkag2 n/a
4 TRCN0000078840 GCAGATAGCATTGTGGGTATT pLKO.1 2523 CDS 100% 10.800 8.640 N Prkag2 n/a
5 TRCN0000430309 ATGAGGTCACACAAGTGTTAT pLKO_005 1704 CDS 100% 13.200 9.240 N PRKAG2 n/a
6 TRCN0000078838 GCTGCAATAGAAGAGAGTAAA pLKO.1 2697 3UTR 100% 13.200 9.240 N Prkag2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535611.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488555 GGCGAATAATCCAGTCCTGCTCTC pLX_317 20.9% 89.3% 93.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_08289 pDONR223 100% 82.7% 86.8% None (many diffs) n/a
3 ccsbBroad304_08289 pLX_304 0% 82.7% 86.8% V5 (many diffs) n/a
4 TRCN0000470612 ACTCCGAGAATTGCACTTTTTGAA pLX_317 25.2% 82.7% 86.8% V5 (many diffs) n/a
5 ccsbBroadEn_15066 pDONR223 0% 82.7% 86.8% None (many diffs) n/a
6 ccsbBroad304_15066 pLX_304 0% 82.7% 86.8% V5 (many diffs) n/a
7 TRCN0000470682 AAGCATTACAACATGTAGGTAAAT pLX_317 27.2% 82.7% 86.8% V5 (many diffs) n/a
8 ccsbBroadEn_03303 pDONR223 100% 52.9% 56.8% None (many diffs) n/a
9 ccsbBroad304_03303 pLX_304 0% 52.9% 56.8% V5 (many diffs) n/a
10 TRCN0000473870 TCGCCAAGCTGGTAATCACGGCAG pLX_317 44.3% 52.9% 56.8% V5 (many diffs) n/a
Download CSV