Transcript: Human XM_006719808.4

PREDICTED: Homo sapiens NIMA related kinase 5 (NEK5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEK5 (341676)
Length:
1909
CDS:
20..1816

Additional Resources:

NCBI RefSeq record:
XM_006719808.4
NBCI Gene record:
NEK5 (341676)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719808.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358267 ACAGATTTCTCTAGGACTAAA pLKO_005 565 CDS 100% 13.200 9.240 N NEK5 n/a
2 TRCN0000358266 CCTTCGGGAAAGCATACTTAG pLKO_005 276 CDS 100% 10.800 7.560 N NEK5 n/a
3 TRCN0000021411 GCCCACCAAGATCAAGGATAT pLKO.1 1164 CDS 100% 10.800 7.560 N NEK5 n/a
4 TRCN0000021412 CCAACAGTACCACAATGACAT pLKO.1 1657 CDS 100% 4.950 3.465 N NEK5 n/a
5 TRCN0000021413 GTAATGGAGAAGAGCCTAGAT pLKO.1 1566 CDS 100% 4.950 3.465 N NEK5 n/a
6 TRCN0000021410 GCCTTCTTCAATTCATTTCAA pLKO.1 428 CDS 100% 5.625 3.375 N NEK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719808.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15307 pDONR223 79.8% 67.9% 42.6% None (many diffs) n/a
2 ccsbBroad304_15307 pLX_304 0% 67.9% 42.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473796 AACCCCACCAACCTATGGAACTGT pLX_317 20.5% 67.9% 42.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_10033 pDONR223 100% 65% 61.8% None (many diffs) n/a
5 ccsbBroad304_10033 pLX_304 0% 65% 61.8% V5 (many diffs) n/a
6 TRCN0000479295 TGCCTTTTGATCCACTCGCCGGAC pLX_317 16.5% 65% 61.8% V5 (many diffs) n/a
Download CSV