Transcript: Human XM_011509911.1

PREDICTED: Homo sapiens sterol O-acyltransferase 1 (SOAT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SOAT1 (6646)
Length:
7111
CDS:
420..2072

Additional Resources:

NCBI RefSeq record:
XM_011509911.1
NBCI Gene record:
SOAT1 (6646)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036443 CCACGTCATACTCCAACTATT pLKO.1 1648 CDS 100% 13.200 18.480 N SOAT1 n/a
2 TRCN0000234513 CCACGTCATACTCCAACTATT pLKO_005 1648 CDS 100% 13.200 18.480 N SOAT1 n/a
3 TRCN0000234512 GAACGTGCCTCGGGTACTAAA pLKO_005 1238 CDS 100% 13.200 18.480 N SOAT1 n/a
4 TRCN0000234511 GTAATGGTCGAATTGACATAA pLKO_005 532 CDS 100% 13.200 10.560 N SOAT1 n/a
5 TRCN0000234515 TAATCACCTCCACTCATATTA pLKO_005 3044 3UTR 100% 15.000 10.500 N SOAT1 n/a
6 TRCN0000036442 GCAGAGGAATTGAAGCCATTT pLKO.1 591 CDS 100% 10.800 7.560 N SOAT1 n/a
7 TRCN0000036440 CCTCCAGAACAAGGAAAGATT pLKO.1 762 CDS 100% 5.625 3.938 N SOAT1 n/a
8 TRCN0000036439 GCACAGGTCTTTGGTTGCTTT pLKO.1 1401 CDS 100% 4.950 3.465 N SOAT1 n/a
9 TRCN0000036441 GCCGATTTGGAATGTTCTGAT pLKO.1 1907 CDS 100% 4.950 3.465 N SOAT1 n/a
10 TRCN0000234514 TGGTCCATGACTGGCTATATT pLKO_005 1687 CDS 100% 15.000 9.000 N SOAT1 n/a
11 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 3992 3UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01576 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01576 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471228 ATTGCGAATAGACCTACGTGCCAT pLX_317 27.9% 100% 100% V5 n/a
4 TRCN0000488886 TAAGCCTAATATATTGCACCGCGA pLX_317 24.2% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000488688 CACCGAGCGGTTAATCGTTAAAGT pLX_317 22.8% 99.9% 99.8% V5 1650_1651insG n/a
Download CSV