Transcript: Human XM_011526317.2

PREDICTED: Homo sapiens p21 (RAC1) activated kinase 4 (PAK4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAK4 (10298)
Length:
2881
CDS:
281..2056

Additional Resources:

NCBI RefSeq record:
XM_011526317.2
NBCI Gene record:
PAK4 (10298)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272510 ACTAAGAGGTGAACATGTATG pLKO_005 2391 3UTR 100% 10.800 15.120 N PAK4 n/a
2 TRCN0000195628 CGATCATGAATGTCCGAAGAG pLKO.1 2544 3UTR 100% 4.050 5.670 N PAK4 n/a
3 TRCN0000010200 CGACCAGCACGAGCAGAAGTT pLKO.1 355 CDS 100% 1.650 2.310 N PAK4 n/a
4 TRCN0000272579 CGACCAGCACGAGCAGAAGTT pLKO_005 355 CDS 100% 1.650 2.310 N PAK4 n/a
5 TRCN0000379713 TCGATCATGAATGTCCGAAGA pLKO_005 2543 3UTR 100% 4.050 3.240 N PAK4 n/a
6 TRCN0000272578 TGGACAACTTCATCAAGATTG pLKO_005 1242 CDS 100% 10.800 7.560 N PAK4 n/a
7 TRCN0000010198 CGAGAATGTGGTGGAGATGTA pLKO.1 1405 CDS 100% 4.950 3.465 N PAK4 n/a
8 TRCN0000272514 CGAGAATGTGGTGGAGATGTA pLKO_005 1405 CDS 100% 4.950 3.465 N PAK4 n/a
9 TRCN0000199898 GCAGCAAAGGTGCCAAAGATG pLKO.1 498 CDS 100% 4.950 3.465 N PAK4 n/a
10 TRCN0000010197 GAGCCACAGCGAGTATCCCAT pLKO.1 1163 CDS 100% 0.880 0.616 N PAK4 n/a
11 TRCN0000010201 CTGCTGGACGAGTTTGAGAAC pLKO.1 533 CDS 100% 4.050 2.430 N PAK4 n/a
12 TRCN0000272577 CTGCTGGACGAGTTTGAGAAC pLKO_005 533 CDS 100% 4.050 2.430 N PAK4 n/a
13 TRCN0000010199 GACTCGATCCTGCTGACCCAT pLKO.1 1610 CDS 100% 0.880 0.528 N PAK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02392 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02392 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469680 TTGCTCGCCAGCAAACCTATAACT pLX_317 24.9% 100% 100% V5 n/a
4 ccsbBroadEn_14960 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14960 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000468245 AGCAGTCATGCCACTATTTGGTAA pLX_317 18.1% 100% 100% V5 n/a
7 TRCN0000491692 AAAGCATGTTTTGACTTAAAGCCT pLX_317 13.9% 100% 100% V5 n/a
8 TRCN0000491616 GCCATTATCAGAACCCAAGTTTCC pLX_317 10.7% 100% 100% V5 (not translated due to prior stop codon) n/a
9 TRCN0000488374 CTGCGTATTCCCTACAAAGGGGTA pLX_317 17.4% 100% 100% V5 (not translated due to prior stop codon) n/a
10 TRCN0000492139 TGAGAAAAGAGGATGCAAATCATT pLX_317 22.2% 99.9% 99.8% V5 1773_1774insG n/a
11 ccsbBroadEn_11480 pDONR223 100% 72% 71.9% None 357_528del;532_854del n/a
12 ccsbBroad304_11480 pLX_304 0% 72% 71.9% V5 357_528del;532_854del n/a
13 TRCN0000480915 TTGACTCAACGCGCCATCTCGTTC pLX_317 26.7% 72% 71.9% V5 357_528del;532_854del n/a
Download CSV