Transcript: Human XM_011532311.2

PREDICTED: Homo sapiens solute carrier family 10 member 7 (SLC10A7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC10A7 (84068)
Length:
3856
CDS:
255..1292

Additional Resources:

NCBI RefSeq record:
XM_011532311.2
NBCI Gene record:
SLC10A7 (84068)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532311.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152464 CCTCTCATCATTGGACAGATT pLKO.1 753 CDS 100% 4.950 6.930 N SLC10A7 n/a
2 TRCN0000154194 CCACGTATAGAACTACGAGAA pLKO.1 2625 3UTR 100% 4.050 5.670 N SLC10A7 n/a
3 TRCN0000153300 GCCAACAATCAAGTCTTGGAT pLKO.1 1172 CDS 100% 3.000 2.400 N SLC10A7 n/a
4 TRCN0000154292 GCCATGAGCATCTCTCTTTAA pLKO.1 1093 CDS 100% 13.200 9.240 N SLC10A7 n/a
5 TRCN0000152650 GCCTGTTACATCCTGGAATTA pLKO.1 2288 3UTR 100% 13.200 9.240 N SLC10A7 n/a
6 TRCN0000157440 GACTGGTTCATGGTCGGAATA pLKO.1 282 CDS 100% 10.800 7.560 N SLC10A7 n/a
7 TRCN0000180984 CCAGTGCTTTGGTGCATCTAA pLKO.1 445 CDS 100% 5.625 3.938 N SLC10A7 n/a
8 TRCN0000157543 GCAGACACAGTGGCTATCATT pLKO.1 1011 CDS 100% 5.625 3.938 N SLC10A7 n/a
9 TRCN0000150111 CTGAAGCCAGAAATAACTGTA pLKO.1 360 CDS 100% 4.950 3.465 N SLC10A7 n/a
10 TRCN0000149358 GACCACTGAAGCCAGAAATAA pLKO.1 355 CDS 100% 15.000 9.000 N SLC10A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532311.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12773 pDONR223 100% 48.3% 48% None 395_396ins39;517_523delATTGTCC;527_1035del n/a
2 ccsbBroad304_12773 pLX_304 0% 48.3% 48% V5 395_396ins39;517_523delATTGTCC;527_1035del n/a
3 TRCN0000471611 CAGCATACGTATGAGAGAGACTTT pLX_317 72.9% 48.3% 48% V5 395_396ins39;517_523delATTGTCC;527_1035del n/a
4 ccsbBroadEn_16026 pDONR223 0% 43.3% 40.2% None (many diffs) n/a
5 ccsbBroad304_16026 pLX_304 0% 43.3% 40.2% V5 (many diffs) n/a
6 ccsbBroadEn_12772 pDONR223 100% 18% 18.2% None 184_186delGAGinsCTT;189G>T;192_1035delinsT n/a
7 ccsbBroad304_12772 pLX_304 0% 18% 18.2% V5 184_186delGAGinsCTT;189G>T;192_1035delinsT n/a
8 TRCN0000481615 TGCCGATCACAAAGCTGGCGATTC pLX_317 100% 18% 18.2% V5 184_186delGAGinsCTT;189G>T;192_1035delinsT n/a
Download CSV