Transcript: Human XM_011541941.3

PREDICTED: Homo sapiens claspin (CLSPN), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLSPN (63967)
Length:
5490
CDS:
109..3966

Additional Resources:

NCBI RefSeq record:
XM_011541941.3
NBCI Gene record:
CLSPN (63967)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541941.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419814 ACGCGAAGCATCTTCAAATAT pLKO_005 3934 CDS 100% 15.000 21.000 N CLSPN n/a
2 TRCN0000413990 GCCAGTCGCCCTATGGTTATT pLKO_005 3610 CDS 100% 13.200 18.480 N CLSPN n/a
3 TRCN0000127921 GATGATGATAAGCGACAGCTA pLKO.1 3268 CDS 100% 2.640 3.696 N CLSPN n/a
4 TRCN0000415371 CATGATTTCTTCAAACGTAAA pLKO_005 889 CDS 100% 10.800 8.640 N CLSPN n/a
5 TRCN0000419953 AGTGAGACTCAGCGCCTTATT pLKO_005 817 CDS 100% 13.200 9.240 N CLSPN n/a
6 TRCN0000423224 GAATATGAAGAGGACGTAATT pLKO_005 3178 CDS 100% 13.200 9.240 N CLSPN n/a
7 TRCN0000426056 GCACTATTGAAGTCATCTAAA pLKO_005 940 CDS 100% 13.200 9.240 N CLSPN n/a
8 TRCN0000424189 TAGCACTGAAAGTTGGAATTG pLKO_005 4016 3UTR 100% 10.800 7.560 N CLSPN n/a
9 TRCN0000129554 CCTTGCTTAGAGCTGAGTCTT pLKO.1 496 CDS 100% 4.950 3.465 N CLSPN n/a
10 TRCN0000128461 GCAATAAGATTGCAGACAGAA pLKO.1 4076 3UTR 100% 4.950 3.465 N CLSPN n/a
11 TRCN0000434995 CAGTGAATGTGAACGTCATAG pLKO_005 1595 CDS 100% 10.800 6.480 N CLSPN n/a
12 TRCN0000130853 GCAGACAGAAATTCCAGTGAT pLKO.1 4087 3UTR 100% 4.950 2.970 N CLSPN n/a
13 TRCN0000127922 GCCAAGAAAGTTACAGCCAAA pLKO.1 3574 CDS 100% 4.050 2.430 N CLSPN n/a
14 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 1942 CDS 100% 4.950 2.475 Y PTMA n/a
15 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 4861 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541941.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08821 pDONR223 100% 91% 90.8% None (many diffs) n/a
2 ccsbBroad304_08821 pLX_304 0% 91% 90.8% V5 (many diffs) n/a
3 TRCN0000479289 AGATCCGGCGTTCGCGACTTCATG pLX_317 11% 91% 90.8% V5 (many diffs) n/a
Download CSV