Transcript: Human XM_011543842.3

PREDICTED: Homo sapiens family with sequence similarity 86 member B1 (FAM86B1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM86B1 (85002)
Length:
2706
CDS:
301..1149

Additional Resources:

NCBI RefSeq record:
XM_011543842.3
NBCI Gene record:
FAM86B1 (85002)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543842.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444970 CTGAGCTGCTGCGGGATATTT pLKO_005 226 5UTR 100% 15.000 7.500 Y EEF2KMT n/a
2 TRCN0000447299 TCTGAGCTGCTGCGGGATATT pLKO_005 225 5UTR 100% 13.200 6.600 Y FAM86C1 n/a
3 TRCN0000172312 CGAGGGAATGTCCTTCTCAAT pLKO.1 667 CDS 100% 4.950 2.475 Y EEF2KMT n/a
4 TRCN0000128827 GCTTTCTCTCAGAACTCATCA pLKO.1 310 CDS 100% 4.950 2.475 Y FAM86B1 n/a
5 TRCN0000129161 GTGCTTTCTCTCAGAACTCAT pLKO.1 308 CDS 100% 4.950 2.475 Y FAM86B1 n/a
6 TRCN0000130496 GACCAGAAACTGTTTCCCTAT pLKO.1 1148 CDS 100% 4.050 2.025 Y FAM86B1 n/a
7 TRCN0000168609 GATGTTGTCATTGCAGCAGAT pLKO.1 799 CDS 100% 4.050 2.025 Y EEF2KMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543842.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488399 TACCTGCGCGCCTAACAATCATGA pLX_317 37.3% 54.4% 40.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_09791 pDONR223 100% 54.3% 40.5% None (many diffs) n/a
3 ccsbBroad304_09791 pLX_304 0% 54.3% 40.5% V5 (many diffs) n/a
4 TRCN0000466174 GGAGAGATGACCTTCCATCATCTG pLX_317 21.3% 54.3% 40.5% V5 (many diffs) n/a
5 TRCN0000488297 ACTAGACGAAAAATGAGGCATGGA pLX_317 30.4% 54.3% 40.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000491961 CCGTTCATGATGGCGTAAGTACGC pLX_317 33.3% 47.3% 39.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV