Transcript: Human XM_017004040.1

PREDICTED: Homo sapiens ankyrin repeat domain 36 (ANKRD36), transcript variant X34, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD36 (375248)
Length:
6195
CDS:
555..5996

Additional Resources:

NCBI RefSeq record:
XM_017004040.1
NBCI Gene record:
ANKRD36 (375248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151047 GATACAAGTGACAAGGATGAT pLKO.1 1485 CDS 100% 4.950 3.465 N ANKRD36 n/a
2 TRCN0000370948 TTACGAACAGAAGGACTATTT pLKO_005 1834 CDS 100% 13.200 7.920 N ANKRD36 n/a
3 TRCN0000155910 CCACAAGTGATGAGAAGGATT pLKO.1 3034 CDS 100% 4.950 2.970 N ANKRD36 n/a
4 TRCN0000365720 TCGCGTCACTGCACCTATTTA pLKO_005 5736 CDS 100% 15.000 7.500 Y ANKRD36 n/a
5 TRCN0000370949 CTCCTGAGCAACCGCCTTTAT pLKO_005 1987 CDS 100% 13.200 6.600 Y ANKRD36 n/a
6 TRCN0000365723 CACGTGCAAAGTGAGCTAAAG pLKO_005 5298 CDS 100% 10.800 5.400 Y ANKRD36 n/a
7 TRCN0000365719 TCGATGTGATCATGATCAAAG pLKO_005 5081 CDS 100% 10.800 5.400 Y ANKRD36 n/a
8 TRCN0000152758 GCTACAAGTGACGACAAAGAT pLKO.1 2217 CDS 100% 5.625 2.813 Y ANKRD36C n/a
9 TRCN0000154273 GCTACAAGTGACGAGAAAGAT pLKO.1 2319 CDS 100% 5.625 2.813 Y ANKRD36C n/a
10 TRCN0000365721 ATGAAGATATGGACATTTCTG pLKO_005 5997 CDS 100% 4.950 2.475 Y ANKRD36 n/a
11 TRCN0000167206 CAAGAAATACAGGATCAACTT pLKO.1 5811 CDS 100% 4.950 2.475 Y ANKRD36B n/a
12 TRCN0000153451 CACTGTGAGCAACTTAGAGTA pLKO.1 4413 CDS 100% 4.950 2.475 Y ANKRD36C n/a
13 TRCN0000167527 GAGAAAGCAGAAAGAGAAGTA pLKO.1 5637 CDS 100% 4.950 2.475 Y ANKRD36B n/a
14 TRCN0000365722 TACCTTCTGCTCACGTATTAT pLKO_005 702 CDS 100% 0.000 0.000 Y ANKRD36 n/a
15 TRCN0000154147 CGAGGAAGATTCTGTTTCGAT pLKO.1 2738 CDS 100% 3.000 1.500 Y ANKRD36C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13635 pDONR223 100% 16.6% 15.6% None (many diffs) n/a
2 ccsbBroad304_13635 pLX_304 0% 16.6% 15.6% V5 (many diffs) n/a
3 TRCN0000477157 GACCCTGATCACACCATGCTACCG pLX_317 46.7% 16.6% 15.6% V5 (many diffs) n/a
4 ccsbBroadEn_12402 pDONR223 100% 12.7% 11.9% None (many diffs) n/a
5 ccsbBroad304_12402 pLX_304 0% 12.7% 11.9% V5 (many diffs) n/a
6 TRCN0000472675 CCTGTATGAGCGAGTCCAAGCGTC pLX_317 56.9% 12.7% 11.9% V5 (many diffs) n/a
7 ccsbBroadEn_13634 pDONR223 100% 8.9% 8.9% None 487delT;490_5439delinsA n/a
8 ccsbBroad304_13634 pLX_304 0% 8.9% 8.9% V5 487delT;490_5439delinsA n/a
9 TRCN0000479689 CACCCTTTACACGGATAGCGCCAG pLX_317 73% 8.9% 8.9% V5 487delT;490_5439delinsA n/a
10 ccsbBroadEn_10271 pDONR223 100% 5.9% 4.5% None (many diffs) n/a
11 ccsbBroad304_10271 pLX_304 0% 5.9% 4.5% V5 (many diffs) n/a
12 TRCN0000478647 CGCTGAAAACACGAATTGAACTCC pLX_317 89.1% 5.9% 4.5% V5 (many diffs) n/a
Download CSV