Transcript: Human XM_017010213.2

PREDICTED: Homo sapiens butyrophilin subfamily 3 member A2 (BTN3A2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTN3A2 (11118)
Length:
1428
CDS:
247..1140

Additional Resources:

NCBI RefSeq record:
XM_017010213.2
NBCI Gene record:
BTN3A2 (11118)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010213.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061424 CCGATACCAATAAGTCAGCCT pLKO.1 1118 CDS 100% 0.660 0.924 N BTN3A2 n/a
2 TRCN0000061425 CGTCGAAGTGAAGGGTTATGA pLKO.1 573 CDS 100% 5.625 3.938 N BTN3A2 n/a
3 TRCN0000429442 CTATATGAAGTAGCAGCATCT pLKO_005 721 CDS 100% 4.050 2.835 N BTN3A2 n/a
4 TRCN0000061423 GCGGGAAATAAGCCTAAGAGA pLKO.1 1032 CDS 100% 3.000 2.100 N BTN3A2 n/a
5 TRCN0000427697 AGGAAATAACTGCTCTGTCCA pLKO_005 959 CDS 100% 2.640 1.848 N BTN3A2 n/a
6 TRCN0000430974 AGATAGAAAGTGAGCAAGAGA pLKO_005 983 CDS 100% 3.000 1.800 N BTN3A2 n/a
7 TRCN0000061426 GAACGTGTATGCAGATGGAAA pLKO.1 348 CDS 100% 4.950 2.475 Y BTN3A2 n/a
8 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 1377 3UTR 100% 4.050 2.025 Y INTS7 n/a
9 TRCN0000061427 GCCAGTTACTTCTTGTGGAGA pLKO.1 931 CDS 100% 2.640 1.320 Y BTN3A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010213.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10209 pDONR223 100% 86.6% 86.6% None 0_1ins120;584_598del n/a
2 ccsbBroad304_10209 pLX_304 0% 86.6% 86.6% V5 0_1ins120;584_598del n/a
3 TRCN0000480174 CACTCTCACGGGGATCCTTCGGCT pLX_317 36.8% 86.6% 86.6% V5 0_1ins120;584_598del n/a
4 ccsbBroadEn_07755 pDONR223 100% 50.6% 46.3% None (many diffs) n/a
5 ccsbBroad304_07755 pLX_304 0% 50.6% 46.3% V5 (many diffs) n/a
6 TRCN0000489565 GTACGATGCCCACACCGAACAAGC pLX_317 22.8% 50.6% 46.3% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000489719 CATACACTGCGTGGTTCGTCGGTA pLX_317 25.4% 50.6% 46.2% V5 (many diffs) n/a
8 ccsbBroadEn_02417 pDONR223 100% 46.8% 44.6% None (many diffs) n/a
9 ccsbBroad304_02417 pLX_304 0% 46.8% 44.6% V5 (many diffs) n/a
10 TRCN0000468589 ACTAGCCCAGTTCCAATTTATGAG pLX_317 22.1% 46.8% 44.6% V5 (many diffs) n/a
11 TRCN0000489137 TTACTCAGCCTTAGGATTTATCGA pLX_317 21.3% 46.8% 44.6% V5 (not translated due to prior stop codon) (many diffs) n/a
12 TRCN0000489559 ACATCAGTGTCGACACGCCAGATT pLX_317 21.9% 46.8% 44.5% V5 (many diffs) n/a
Download CSV