Transcript: Human XM_017013822.1

PREDICTED: Homo sapiens solute carrier family 52 member 2 (SLC52A2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC52A2 (79581)
Length:
1277
CDS:
175..1020

Additional Resources:

NCBI RefSeq record:
XM_017013822.1
NBCI Gene record:
SLC52A2 (79581)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013822.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356990 TAAGGCCTATCAGCTTCTATC pLKO_005 480 CDS 100% 10.800 15.120 N SLC52A2 n/a
2 TRCN0000369172 CTACCTGTGGTGGTCAAAGAG pLKO_005 274 CDS 100% 4.950 6.930 N SLC52A2 n/a
3 TRCN0000377313 GTACACTCGTGGACACCTACA pLKO_005 1117 3UTR 100% 4.050 5.670 N SLC52A2 n/a
4 TRCN0000356989 TGGCGTGTTCTCCTACGTGAA pLKO_005 831 CDS 100% 4.050 5.670 N SLC52A2 n/a
5 TRCN0000008272 CCTAAGGCCTATCAGCTTCTA pLKO.1 478 CDS 100% 4.950 3.465 N SLC52A2 n/a
6 TRCN0000008271 TCCATAGGAGATCCTGGCTTT pLKO.1 1141 3UTR 100% 4.050 2.835 N SLC52A2 n/a
7 TRCN0000377314 CCTGTCTTTCCCTCAATGCTG pLKO_005 1053 3UTR 100% 2.640 1.848 N SLC52A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013822.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04082 pDONR223 100% 63.1% 63.1% None 129_130ins492 n/a
2 ccsbBroad304_04082 pLX_304 0% 63.1% 63.1% V5 129_130ins492 n/a
3 TRCN0000466478 ATCGGAGGAATCCGAACGGGGTTG pLX_317 28.3% 63.1% 63.1% V5 129_130ins492 n/a
4 TRCN0000489152 GTATGCTAAACCCCGGAGGACATT pLX_317 28.3% 63.1% 63.1% V5 (not translated due to prior stop codon) 129_130ins492 n/a
5 TRCN0000488764 CGGGTTCTATGTGGTGATGTTCCT pLX_317 24.8% 63% 63% V5 129_130ins492;843_844insG n/a
6 TRCN0000489441 ACCGGTACGGAACATTAGAGCTGC pLX_317 27.2% 54.2% 53.3% V5 (many diffs) n/a
7 TRCN0000489640 CCATAATACTCTCTGATTAAAAAA pLX_317 27.4% 54.2% 53.3% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_08465 pDONR223 100% 54.1% 53.1% None (many diffs) n/a
9 ccsbBroad304_08465 pLX_304 0% 54.1% 53.1% V5 (many diffs) n/a
10 TRCN0000481632 AGCTTTTCTCGGTGTTGGCAAGAC pLX_317 36.3% 54.1% 53.1% V5 (many diffs) n/a
Download CSV