Transcript: Human XM_017014588.1

PREDICTED: Homo sapiens FERM domain containing 3 (FRMD3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FRMD3 (257019)
Length:
4983
CDS:
16..1686

Additional Resources:

NCBI RefSeq record:
XM_017014588.1
NBCI Gene record:
FRMD3 (257019)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416157 GTATCAAGCAGCAAGATATTT pLKO_005 847 CDS 100% 15.000 21.000 N FRMD3 n/a
2 TRCN0000159100 GCTATATTCAATGCTAGTGAT pLKO.1 1711 3UTR 100% 4.950 6.930 N FRMD3 n/a
3 TRCN0000160110 CCATAATTCACTGCACTTAAA pLKO.1 1830 3UTR 100% 13.200 9.240 N FRMD3 n/a
4 TRCN0000161516 GCCAGATGTCTGCAAATTGAA pLKO.1 666 CDS 100% 5.625 3.938 N FRMD3 n/a
5 TRCN0000191833 GTCTGCAAATTGAAGTTTGAA pLKO.1 673 CDS 100% 5.625 3.938 N Frmd3 n/a
6 TRCN0000163692 GCTGTCAACAGGTGTTCCTTA pLKO.1 1773 3UTR 100% 4.950 3.465 N FRMD3 n/a
7 TRCN0000161190 GCTTGAACCTAACAAGTCCAT pLKO.1 150 CDS 100% 2.640 1.848 N FRMD3 n/a
8 TRCN0000159056 GATGTCTGCAAATTGAAGTTT pLKO.1 670 CDS 100% 5.625 3.375 N FRMD3 n/a
9 TRCN0000160548 CCTTTAAGTTAGCTTTCCATA pLKO.1 1814 3UTR 100% 4.950 2.970 N FRMD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13478 pDONR223 100% 95.2% 93.1% None (many diffs) n/a
2 ccsbBroad304_13478 pLX_304 0% 95.2% 93.1% V5 (many diffs) n/a
3 TRCN0000492301 AGGTTAACTCATATGTTAACTCGG pLX_317 21.7% 95.2% 93.1% V5 (many diffs) n/a
4 ccsbBroadEn_16137 pDONR223 0% 34.6% 29.5% None (many diffs) n/a
5 ccsbBroad304_16137 pLX_304 0% 34.6% 29.5% V5 (many diffs) n/a
6 TRCN0000479067 CGACCCCTCCCCAGTTATGTTCCA pLX_317 71.5% 34.6% 5.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV