Transcript: Human XM_017014706.2

PREDICTED: Homo sapiens aquaporin 7 (AQP7), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AQP7 (364)
Length:
3580
CDS:
539..1141

Additional Resources:

NCBI RefSeq record:
XM_017014706.2
NBCI Gene record:
AQP7 (364)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014706.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059693 GCTGTGACCTTTGCTAACTGT pLKO.1 653 CDS 100% 3.000 2.100 N AQP7 n/a
2 TRCN0000416490 GGAACAGAGGCGCTGGTGATA pLKO_005 965 CDS 100% 1.650 1.155 N AQP7 n/a
3 TRCN0000415705 GGAGGAAGTTTCCGGTCTATG pLKO_005 693 CDS 100% 10.800 6.480 N AQP7 n/a
4 TRCN0000434757 TGGAGGATTCTGTGGCGTATG pLKO_005 1585 3UTR 100% 6.000 3.600 N AQP7 n/a
5 TRCN0000418146 CCTATCTAGGTGGCATCATCT pLKO_005 1519 3UTR 100% 4.950 2.970 N AQP7 n/a
6 TRCN0000059695 CCTTGGCATGAACACAGGATA pLKO.1 1015 CDS 100% 4.950 2.970 N AQP7 n/a
7 TRCN0000059694 GCCGAGTTCATGAGCACATAT pLKO.1 331 5UTR 100% 13.200 6.600 Y AQP7 n/a
8 TRCN0000059697 CGTATGAAGACCACGGGATAA pLKO.1 1600 3UTR 100% 10.800 5.400 Y AQP7 n/a
9 TRCN0000059696 CCTTGGTGTCAACTTGGGTTT pLKO.1 568 CDS 100% 4.050 2.025 Y AQP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014706.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10684 pDONR223 100% 91.3% 89.3% None (many diffs) n/a
2 ccsbBroad304_10684 pLX_304 0% 91.3% 89.3% V5 (many diffs) n/a
3 TRCN0000480437 ATTTCATTATTATATTTCTAGTTA pLX_317 63% 91.3% 89.3% V5 (many diffs) n/a
4 ccsbBroadEn_13660 pDONR223 100% 32.9% 21.8% None (many diffs) n/a
5 ccsbBroad304_13660 pLX_304 0% 32.9% 21.8% V5 (many diffs) n/a
6 TRCN0000469925 TGAGAACACATCCGGTCGACACGT pLX_317 100% 32.9% 21.8% V5 (many diffs) n/a
Download CSV