Transcript: Human XM_017022037.1

PREDICTED: Homo sapiens VPS39 subunit of HOPS complex (VPS39), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS39 (23339)
Length:
3281
CDS:
179..2761

Additional Resources:

NCBI RefSeq record:
XM_017022037.1
NBCI Gene record:
VPS39 (23339)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382522 GACGTTGGTTGCAACAGATTT pLKO_005 311 CDS 100% 13.200 18.480 N VPS39 n/a
2 TRCN0000146371 CCACAAACACTATGACCGAAA pLKO.1 2314 CDS 100% 4.050 3.240 N VPS39 n/a
3 TRCN0000381725 ACGGATGTGTGTGGCAGTAAA pLKO_005 547 CDS 100% 13.200 9.240 N VPS39 n/a
4 TRCN0000148592 CCATGTGGTTTCCCAGTTTAA pLKO.1 385 CDS 100% 13.200 9.240 N VPS39 n/a
5 TRCN0000379937 GTCCATGACCTATTGACATTT pLKO_005 440 CDS 100% 13.200 9.240 N VPS39 n/a
6 TRCN0000381177 ATCTCACCGTGGTACTCAATG pLKO_005 816 CDS 100% 10.800 7.560 N VPS39 n/a
7 TRCN0000379813 ATTACCTCAGGAGGATCAAAC pLKO_005 1004 CDS 100% 10.800 7.560 N VPS39 n/a
8 TRCN0000379518 GAAACGAAGTCAATTGGTAAA pLKO_005 1411 CDS 100% 10.800 7.560 N VPS39 n/a
9 TRCN0000146521 CCAGCAAACACTCAGATCAAT pLKO.1 2519 CDS 100% 5.625 3.938 N VPS39 n/a
10 TRCN0000146912 CATGGTGTGTAAGAAGAAGAT pLKO.1 2701 CDS 100% 4.950 3.465 N VPS39 n/a
11 TRCN0000146375 CCTCGGCTTCTTAATAGAGAA pLKO.1 1909 CDS 100% 4.950 3.465 N VPS39 n/a
12 TRCN0000120893 GCCAGCAAACACTCAGATCAA pLKO.1 2518 CDS 100% 4.950 3.465 N Vps39 n/a
13 TRCN0000345310 GCCAGCAAACACTCAGATCAA pLKO_005 2518 CDS 100% 4.950 3.465 N Vps39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02753 pDONR223 100% 97.7% 96.2% None (many diffs) n/a
2 ccsbBroad304_02753 pLX_304 0% 97.7% 96.2% V5 (many diffs) n/a
3 TRCN0000472102 CAATCTACATGATTAGCGGGCTCA pLX_317 19.4% 97.7% 96.2% V5 (many diffs) n/a
4 ccsbBroadEn_11723 pDONR223 100% 79.7% 78.3% None (many diffs) n/a
5 ccsbBroad304_11723 pLX_304 0% 79.7% 78.3% V5 (many diffs) n/a
6 TRCN0000480144 GCATTGTCAAAAATGCGGCATATC pLX_317 17.6% 79.7% 78.3% V5 (many diffs) n/a
Download CSV