Transcript: Human XM_017022336.1

PREDICTED: Homo sapiens ring finger protein 111 (RNF111), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF111 (54778)
Length:
5044
CDS:
484..3513

Additional Resources:

NCBI RefSeq record:
XM_017022336.1
NBCI Gene record:
RNF111 (54778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428624 ATGACTTACCTGCGCAGATTT pLKO_005 3586 3UTR 100% 13.200 18.480 N RNF111 n/a
2 TRCN0000429485 GAGTGACTGCAGCTACTTATA pLKO_005 2996 CDS 100% 13.200 18.480 N RNF111 n/a
3 TRCN0000416958 ACGGAACCGCAGTAGGATTTC pLKO_005 1638 CDS 100% 10.800 15.120 N RNF111 n/a
4 TRCN0000004206 CCAGCCAATTTCGCACCATAT pLKO.1 2736 CDS 100% 10.800 15.120 N RNF111 n/a
5 TRCN0000004207 CCGTTACATTTCATCAGGATT pLKO.1 3132 CDS 100% 4.950 6.930 N RNF111 n/a
6 TRCN0000004210 CCGCCTCAAGTGGATTATGTT pLKO.1 2584 CDS 100% 5.625 4.500 N RNF111 n/a
7 TRCN0000004208 GCTCTGATGAACACTAAATAT pLKO.1 4288 3UTR 100% 15.000 10.500 N RNF111 n/a
8 TRCN0000414361 CCATAGTGCACGGTCTCATAA pLKO_005 1080 CDS 100% 13.200 9.240 N RNF111 n/a
9 TRCN0000004209 CCAAGTGATGAAGATAATGAT pLKO.1 925 CDS 100% 5.625 3.938 N RNF111 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12078 pDONR223 100% 97.5% 97.5% None (many diffs) n/a
2 ccsbBroad304_12078 pLX_304 0% 97.5% 97.5% V5 (many diffs) n/a
3 TRCN0000480460 CAAGATGAATGATGGTTTCAATAT pLX_317 12.4% 97.5% 97.5% V5 (many diffs) n/a
4 ccsbBroadEn_12077 pDONR223 100% 13.5% 13.5% None 1_2616del n/a
5 ccsbBroad304_12077 pLX_304 0% 13.5% 13.5% V5 1_2616del n/a
6 TRCN0000478704 TGACCCTCATCGTCCTTGATTTGC pLX_317 76.3% 13.5% 13.5% V5 1_2616del n/a
Download CSV