Transcript: Human XM_017027518.1

PREDICTED: Homo sapiens zinc finger protein 254 (ZNF254), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF254 (9534)
Length:
3997
CDS:
365..2125

Additional Resources:

NCBI RefSeq record:
XM_017027518.1
NBCI Gene record:
ZNF254 (9534)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107876 ACCTCACCACAGATAAGATAA pLKO.1 2076 CDS 100% 13.200 9.240 N ZNF254 n/a
2 TRCN0000016343 GCACCTCACCACAGATAAGAT pLKO.1 2074 CDS 100% 5.625 3.938 N ZNF254 n/a
3 TRCN0000107877 CCCTTACTACACATGAAATAA pLKO.1 900 CDS 100% 15.000 9.000 N ZNF254 n/a
4 TRCN0000016344 CCCAGGTATGTGTCCTCATTT pLKO.1 394 CDS 100% 13.200 7.920 N ZNF254 n/a
5 TRCN0000016347 CCCTGGAATATGAAGCGACAT pLKO.1 356 5UTR 100% 4.050 2.430 N ZNF254 n/a
6 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1850 CDS 100% 15.000 7.500 Y ZNF443 n/a
7 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1850 CDS 100% 15.000 7.500 Y Zfp97 n/a
8 TRCN0000236730 CCCTTACTACACATAAGATAA pLKO_005 1236 CDS 100% 13.200 6.600 Y ZNF98 n/a
9 TRCN0000428574 CTGAAGAGAAACCCTACAAAT pLKO_005 1767 CDS 100% 13.200 6.600 Y ZNF138 n/a
10 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1179 CDS 100% 13.200 6.600 Y Zfp934 n/a
11 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1179 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
12 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1179 CDS 100% 13.200 6.600 Y EG668616 n/a
13 TRCN0000107875 CACTTGATTGTAGGTAAGATA pLKO.1 2313 3UTR 100% 5.625 2.813 Y ZNF254 n/a
14 TRCN0000018187 CCCAGAGCAAAGTATTTCAAT pLKO.1 591 CDS 100% 5.625 2.813 Y ZNF90 n/a
15 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1177 CDS 100% 4.950 2.475 Y ZNF254 n/a
16 TRCN0000107878 CCCTAACTAAACATAAGAGAA pLKO.1 1992 CDS 100% 4.950 2.475 Y ZNF254 n/a
17 TRCN0000016345 CCTCAAATCTTACTACACATA pLKO.1 978 CDS 100% 4.950 2.475 Y ZNF254 n/a
18 TRCN0000107758 TGTCTCTAAGCCAGACCTGAT pLKO.1 310 5UTR 100% 4.050 2.025 Y ZNF273 n/a
19 TRCN0000107879 CCACAGATAAGATAACTCATA pLKO.1 2082 CDS 100% 4.950 2.970 N ZNF254 n/a
20 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 848 CDS 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02188 pDONR223 100% 88.9% 88.9% None 0_1ins219 n/a
2 ccsbBroad304_02188 pLX_304 0% 88.9% 88.9% V5 0_1ins219 n/a
3 TRCN0000476436 TCCGTGTTGGTCAAGCGACGCGCC pLX_317 12.5% 88.9% 88.9% V5 0_1ins219 n/a
4 ccsbBroadEn_09784 pDONR223 100% 60.9% 51.8% None (many diffs) n/a
5 ccsbBroad304_09784 pLX_304 0% 60.9% 51.8% V5 (many diffs) n/a
6 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 60.9% 51.8% V5 (many diffs) n/a
7 ccsbBroadEn_15167 pDONR223 53.6% 59.8% 20.5% None (many diffs) n/a
8 ccsbBroad304_15167 pLX_304 0% 59.8% 20.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV