Transcript: Human XM_017029431.1

PREDICTED: Homo sapiens SSX family member 7 (SSX7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SSX7 (280658)
Length:
570
CDS:
1..390

Additional Resources:

NCBI RefSeq record:
XM_017029431.1
NBCI Gene record:
SSX7 (280658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422739 ACCAAGGGAATCAGGTTGAAC pLKO_005 266 CDS 100% 4.950 3.465 N SSX7 n/a
2 TRCN0000433847 ACCTAGGGCTGGTGCTCAAAT pLKO_005 30 CDS 100% 13.200 7.920 N SSX7 n/a
3 TRCN0000115838 CTCCCACCTTTCATGCATAAT pLKO.1 199 CDS 100% 13.200 7.920 N SSX7 n/a
4 TRCN0000115840 CCTCCCACCTTTCATGCATAA pLKO.1 198 CDS 100% 10.800 6.480 N SSX7 n/a
5 TRCN0000115723 CTTCGATGATATTGCCAAATA pLKO.1 72 CDS 100% 13.200 6.600 Y SSX9P n/a
6 TRCN0000020146 CCTTCGATGATATTGCCAAAT pLKO.1 71 CDS 100% 10.800 5.400 Y SSX3 n/a
7 TRCN0000021760 GCCAAATACTTCTCTAAGAAA pLKO.1 85 CDS 100% 5.625 2.813 Y SSX4 n/a
8 TRCN0000115731 GCTATGTGTATATGAAGAGAA pLKO.1 140 CDS 100% 4.950 2.475 Y SSX8P n/a
9 TRCN0000020147 GCTGGTGATTTATGAAGAGAT pLKO.1 383 CDS 100% 4.950 2.475 Y SSX3 n/a
10 TRCN0000153294 GAAGAGAAAGTATGAGGCCAT pLKO.1 153 CDS 100% 2.160 1.080 Y SSX5 n/a
11 TRCN0000115807 GCAAGTGTTCACAACAGTGAA pLKO.1 543 3UTR 100% 0.495 0.248 Y SSX6P n/a
12 TRCN0000152838 GCAAGTGTTCACAACAGTGAA pLKO.1 543 3UTR 100% 0.495 0.248 Y SSX5 n/a
13 TRCN0000115722 GCCCATGATGAGAAGCAGAAT pLKO.1 455 3UTR 100% 4.950 2.475 Y SSX9P n/a
14 TRCN0000021763 CCAGAGAATCTTCCCGAAGAT pLKO.1 312 CDS 100% 0.495 0.248 Y SSX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11160 pDONR223 100% 71.8% 60.3% None (many diffs) n/a
2 ccsbBroad304_11160 pLX_304 0% 71.8% 60.3% V5 (many diffs) n/a
3 TRCN0000466761 AGTGCTGCACGATATCGTACACTG pLX_317 72.1% 71.8% 60.3% V5 (many diffs) n/a
4 ccsbBroadEn_02357 pDONR223 100% 66.3% 56% None (many diffs) n/a
5 ccsbBroad304_02357 pLX_304 0% 66.3% 56% V5 (many diffs) n/a
6 TRCN0000479719 TGCAACAGTCTTCCTTTAACGATA pLX_317 61.3% 66.3% 56% V5 (many diffs) n/a
7 ccsbBroadEn_02358 pDONR223 100% 63.4% 53.1% None (many diffs) n/a
8 ccsbBroad304_02358 pLX_304 0% 63.4% 53.1% V5 (many diffs) n/a
9 TRCN0000472750 CCACTTCCGTACTCCCCGCTCGCG pLX_317 74.7% 63.4% 53.1% V5 (many diffs) n/a
10 TRCN0000487931 GACCATATAATGACCGGCCAGGGG pLX_317 48.5% 63.4% 51.3% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000487987 CTCGTAAATATTTCCCCCGTTCGT pLX_317 48.3% 63.3% 51% V5 (many diffs) n/a
12 ccsbBroadEn_07001 pDONR223 100% 63.2% 51.3% None (many diffs) n/a
13 ccsbBroad304_07001 pLX_304 0% 63.2% 51.3% V5 (many diffs) n/a
14 TRCN0000479224 GCACGATTCGGCACCAGTAAATTC pLX_317 64.8% 62.9% 50.7% V5 (many diffs) n/a
15 ccsbBroadEn_07003 pDONR223 100% 62.5% 46.6% None (many diffs) n/a
16 ccsbBroad304_07003 pLX_304 0% 62.5% 46.6% V5 (many diffs) n/a
17 TRCN0000475229 CCACCCTATAATTCAACTACCTAC pLX_317 62.8% 62.5% 46.6% V5 (many diffs) n/a
18 ccsbBroadEn_01604 pDONR223 100% 61.4% 44.1% None (many diffs) n/a
19 ccsbBroad304_01604 pLX_304 0% 61.4% 44.1% V5 (many diffs) n/a
20 TRCN0000467573 GAGGTGCGGTAGTGGCTGTCGGAC pLX_317 86% 61.4% 44.1% V5 (many diffs) n/a
21 ccsbBroadEn_01605 pDONR223 100% 53.6% 49.3% None (many diffs) n/a
22 ccsbBroad304_01605 pLX_304 0% 53.6% 49.3% V5 (many diffs) n/a
23 TRCN0000479927 TTAGGGCCACATCTTTCATTTATA pLX_317 56.6% 53.6% 49.3% V5 (many diffs) n/a
24 TRCN0000491259 ACCCAGTTTATTCAAGCATACCTT pLX_317 34.3% 53.6% 49.3% V5 (not translated due to prior stop codon) (many diffs) n/a
25 TRCN0000489622 TCTCTACATGTCCGATTTTAATCG pLX_317 50.9% 53.5% 49.1% V5 (many diffs) n/a
26 ccsbBroadEn_07002 pDONR223 100% 52.2% 39.9% None (many diffs) n/a
27 ccsbBroad304_07002 pLX_304 0% 52.2% 39.9% V5 (many diffs) n/a
28 TRCN0000470951 GTCCCTCCTCTCTTCTGCAACACA pLX_317 67.7% 52.2% 39.9% V5 (many diffs) n/a
Download CSV