Transcript: Human XM_017030107.2

PREDICTED: Homo sapiens neuroblastoma breakpoint family member 1 (LOC102724250), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC102724250 (102724250)
Length:
2598
CDS:
828..2564

Additional Resources:

NCBI RefSeq record:
XM_017030107.2
NBCI Gene record:
LOC102724250 (102724250)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017030107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415679 ATGACAATGATCACGATGAAG pLKO_005 2197 CDS 100% 4.950 3.465 N NBPF1 n/a
2 TRCN0000352961 CTGAGGAGCTCAGGCAATATA pLKO_005 1153 CDS 100% 15.000 7.500 Y NBPF11 n/a
3 TRCN0000255811 GAGGAGCTCAGGCAATATAAA pLKO_005 1155 CDS 100% 15.000 7.500 Y NBPF15 n/a
4 TRCN0000242329 TGAGGAGCTCAGGCAATATAA pLKO_005 1154 CDS 100% 15.000 7.500 Y NBPF9 n/a
5 TRCN0000244558 AGAGTGCAAAGACCTCATAAA pLKO_005 1883 CDS 100% 13.200 6.600 Y NBPF10 n/a
6 TRCN0000161288 GTGCCATCACTTGTTCAAATA pLKO.1 1507 CDS 100% 13.200 6.600 Y NBPF1 n/a
7 TRCN0000242432 TGTGCCATCACTTGTTCAAAT pLKO_005 1506 CDS 100% 13.200 6.600 Y NBPF11 n/a
8 TRCN0000244560 GAGGATGCTGTACACATTATT pLKO_005 2448 CDS 100% 15.000 7.500 Y NBPF10 n/a
9 TRCN0000364789 AGGATGCTGTACACATTATTC pLKO_005 2449 CDS 100% 13.200 6.600 Y NBPF14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017030107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15282 pDONR223 73.8% 86.8% 83.9% None (many diffs) n/a
2 ccsbBroad304_15282 pLX_304 0% 86.8% 83.9% V5 (many diffs) n/a
3 TRCN0000469491 AAATCTAACGTTAGACAGGGAAAT pLX_317 16.1% 83.8% 80.4% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_09966 pDONR223 100% 56.3% 27% None (many diffs) n/a
5 ccsbBroad304_09966 pLX_304 0% 56.3% 27% V5 (many diffs) n/a
6 TRCN0000476622 TTTTACCGTGCTGGCCAAGGACTT pLX_317 19.5% 56.3% 27% V5 (many diffs) n/a
7 ccsbBroadEn_15343 pDONR223 79.7% 51.2% 48.7% None (many diffs) n/a
8 ccsbBroad304_15343 pLX_304 0% 51.2% 48.7% V5 (many diffs) n/a
9 TRCN0000476676 CTCGGTCCAAATACGACCGTGACC pLX_317 14.4% 51.2% 48.7% V5 (many diffs) n/a
10 ccsbBroadEn_12795 pDONR223 100% 51.2% 32% None (many diffs) n/a
11 ccsbBroad304_12795 pLX_304 0% 51.2% 32% V5 (many diffs) n/a
12 TRCN0000466247 ATCAGCAGGTCACACTGTTGAGTG pLX_317 41.2% 51.2% 32% V5 (many diffs) n/a
13 ccsbBroadEn_12247 pDONR223 100% 47.5% 21.2% None (many diffs) n/a
14 ccsbBroad304_12247 pLX_304 0% 47.5% 21.2% V5 (many diffs) n/a
15 TRCN0000475390 TTACACTGAACGGGCTATGATCAG pLX_317 19.6% 47.5% 21.2% V5 (many diffs) n/a
Download CSV