Transcript: Mouse XM_017312297.1

PREDICTED: Mus musculus p21 protein (Cdc42/Rac)-activated kinase 4 (Pak4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pak4 (70584)
Length:
2894
CDS:
282..2063

Additional Resources:

NCBI RefSeq record:
XM_017312297.1
NBCI Gene record:
Pak4 (70584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025232 ACTCTGCTGCTTGACGAATTT pLKO.1 528 CDS 100% 13.200 9.240 N Pak4 n/a
2 TRCN0000374464 TTTGATTCCATGACTTGTAAA pLKO_005 2215 3UTR 100% 13.200 9.240 N Pak4 n/a
3 TRCN0000374396 TGGGACAGAGACGACACTATG pLKO_005 2352 3UTR 100% 10.800 7.560 N Pak4 n/a
4 TRCN0000025230 CCCTCGTTCCTATCTAGACAA pLKO.1 1235 CDS 100% 4.950 3.465 N Pak4 n/a
5 TRCN0000319714 CCCTCGTTCCTATCTAGACAA pLKO_005 1235 CDS 100% 4.950 3.465 N Pak4 n/a
6 TRCN0000025231 TGACATCAAGAGTGACTCTAT pLKO.1 1604 CDS 100% 4.950 3.465 N Pak4 n/a
7 TRCN0000319775 TGACATCAAGAGTGACTCTAT pLKO_005 1604 CDS 100% 4.950 3.465 N Pak4 n/a
8 TRCN0000025233 CGCAAGCAGCAAAGACGTGAA pLKO.1 1350 CDS 100% 4.050 2.835 N Pak4 n/a
9 TRCN0000319774 CGCAAGCAGCAAAGACGTGAA pLKO_005 1350 CDS 100% 4.050 2.835 N Pak4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02392 pDONR223 100% 86.2% 92.5% None (many diffs) n/a
2 ccsbBroad304_02392 pLX_304 0% 86.2% 92.5% V5 (many diffs) n/a
3 TRCN0000469680 TTGCTCGCCAGCAAACCTATAACT pLX_317 24.9% 86.2% 92.5% V5 (many diffs) n/a
4 ccsbBroadEn_14960 pDONR223 0% 86.2% 92.5% None (many diffs) n/a
5 ccsbBroad304_14960 pLX_304 0% 86.2% 92.5% V5 (many diffs) n/a
6 TRCN0000468245 AGCAGTCATGCCACTATTTGGTAA pLX_317 18.1% 86.2% 92.5% V5 (many diffs) n/a
7 TRCN0000491692 AAAGCATGTTTTGACTTAAAGCCT pLX_317 13.9% 86.2% 92.5% V5 (many diffs) n/a
8 TRCN0000491616 GCCATTATCAGAACCCAAGTTTCC pLX_317 10.7% 86.2% 92.5% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000488374 CTGCGTATTCCCTACAAAGGGGTA pLX_317 17.4% 86.2% 92.5% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000492139 TGAGAAAAGAGGATGCAAATCATT pLX_317 22.2% 86.2% 92.4% V5 (many diffs) n/a
11 ccsbBroadEn_11480 pDONR223 100% 63.9% 70.1% None (many diffs) n/a
12 ccsbBroad304_11480 pLX_304 0% 63.9% 70.1% V5 (many diffs) n/a
13 TRCN0000480915 TTGACTCAACGCGCCATCTCGTTC pLX_317 26.7% 63.9% 70.1% V5 (many diffs) n/a
Download CSV