Transcript: Mouse XM_017313009.1

PREDICTED: Mus musculus solute carrier family 10 (sodium/bile acid cotransporter family), member 7 (Slc10a7), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc10a7 (76775)
Length:
852
CDS:
248..754

Additional Resources:

NCBI RefSeq record:
XM_017313009.1
NBCI Gene record:
Slc10a7 (76775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313009.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000452628 CATTGCCGTCGCAACGATATT pLKO_005 379 CDS 100% 13.200 18.480 N Slc10a7 n/a
2 TRCN0000110824 CTGTGTCTTCTGCCGTGATTT pLKO.1 597 CDS 100% 13.200 9.240 N Slc10a7 n/a
3 TRCN0000110821 CCAGCAGCAATATGGCTCTTT pLKO.1 500 CDS 100% 4.950 3.465 N Slc10a7 n/a
4 TRCN0000110822 GAATGGTTCATGGTCGGGATA pLKO.1 275 CDS 100% 4.050 2.835 N Slc10a7 n/a
5 TRCN0000110823 CCAAATCTTCACACTTGCCTT pLKO.1 475 CDS 100% 2.640 1.848 N Slc10a7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313009.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16026 pDONR223 0% 81.3% 80.3% None (many diffs) n/a
2 ccsbBroad304_16026 pLX_304 0% 81.3% 80.3% V5 (many diffs) n/a
3 ccsbBroadEn_12773 pDONR223 100% 75.8% 72% None (many diffs) n/a
4 ccsbBroad304_12773 pLX_304 0% 75.8% 72% V5 (many diffs) n/a
5 TRCN0000471611 CAGCATACGTATGAGAGAGACTTT pLX_317 72.9% 75.8% 72% V5 (many diffs) n/a
6 ccsbBroadEn_12772 pDONR223 100% 31.9% 33.9% None (many diffs) n/a
7 ccsbBroad304_12772 pLX_304 0% 31.9% 33.9% V5 (many diffs) n/a
8 TRCN0000481615 TGCCGATCACAAAGCTGGCGATTC pLX_317 100% 31.9% 33.9% V5 (many diffs) n/a
Download CSV