Transcript: Mouse XM_017314791.1

PREDICTED: Mus musculus ribosomal protein S6 kinase, polypeptide 1 (Rps6kb1), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rps6kb1 (72508)
Length:
1054
CDS:
92..943

Additional Resources:

NCBI RefSeq record:
XM_017314791.1
NBCI Gene record:
Rps6kb1 (72508)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145927 AATGAAAGCATGGACCATGG pXPR_003 GGG 167 20% 2 0.2898 Rps6kb1 RPS6KB1 75613
2 BRDN0001145729 CTTCGGGTACTTGGTAAAGG pXPR_003 GGG 296 35% 3 0.2002 Rps6kb1 RPS6KB1 75612
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022904 GCATGGAACATTGTGAGAAAT pLKO.1 285 CDS 100% 13.200 10.560 N Rps6kb1 n/a
2 TRCN0000297869 GCATGGAACATTGTGAGAAAT pLKO_005 285 CDS 100% 13.200 10.560 N Rps6kb1 n/a
3 TRCN0000350402 TTTGCCATGAAGGTGCTTAAA pLKO_005 449 CDS 100% 13.200 9.240 N RPS6KB1 n/a
4 TRCN0000022908 ACATTGTTACACAGCCAGTAT pLKO.1 885 CDS 100% 4.950 3.465 N Rps6kb1 n/a
5 TRCN0000280574 ACATTGTTACACAGCCAGTAT pLKO_005 885 CDS 100% 4.950 3.465 N Rps6kb1 n/a
6 TRCN0000003161 TATTTGCCATGAAGGTGCTTA pLKO.1 447 CDS 100% 4.950 3.465 N RPS6KB1 n/a
7 TRCN0000022905 CCCTTTCATTGTGGACCTGAT pLKO.1 547 CDS 100% 4.050 2.835 N Rps6kb1 n/a
8 TRCN0000280514 CCCTTTCATTGTGGACCTGAT pLKO_005 547 CDS 100% 4.050 2.835 N Rps6kb1 n/a
9 TRCN0000022907 GCAGTTAGAAAGAGAGGGAAT pLKO.1 637 CDS 100% 4.050 2.430 N Rps6kb1 n/a
10 TRCN0000280573 GCAGTTAGAAAGAGAGGGAAT pLKO_005 637 CDS 100% 4.050 2.430 N Rps6kb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11109 pDONR223 100% 55.3% 39.8% None (many diffs) n/a
2 ccsbBroad304_11109 pLX_304 0% 55.3% 39.8% V5 (many diffs) n/a
3 TRCN0000479002 ATGGCACAGCTAGAATGACTTCCC pLX_317 27.7% 55.3% 39.8% V5 (many diffs) n/a
4 ccsbBroadEn_14833 pDONR223 0% 55.3% 39.8% None (many diffs) n/a
5 ccsbBroad304_14833 pLX_304 49.9% 55.3% 39.8% V5 (many diffs) n/a
6 TRCN0000481178 ACCACACGATGAGTAGACCGGCCA pLX_317 32.8% 55.3% 39.8% V5 (many diffs) n/a
7 TRCN0000489919 CGAACCTTCGACTGCACGAATTCC pLX_317 24.5% 47.5% 34.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV