Transcript: Mouse XM_017315433.1

PREDICTED: Mus musculus pre-mRNA processing factor 4B (Prpf4b), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prpf4b (19134)
Length:
5412
CDS:
155..3178

Additional Resources:

NCBI RefSeq record:
XM_017315433.1
NBCI Gene record:
Prpf4b (19134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294535 GTCCTAGATAAACGTTATAAT pLKO_005 2198 CDS 100% 15.000 21.000 N Prpf4b n/a
2 TRCN0000294536 TTAACACCGAGGGTGATATTT pLKO_005 3313 3UTR 100% 15.000 21.000 N Prpf4b n/a
3 TRCN0000025363 CCGGATAATATTCTGGTTAAT pLKO.1 2606 CDS 100% 13.200 18.480 N Prpf4b n/a
4 TRCN0000025360 CCGGAGATCATTATAGGTAAA pLKO.1 2726 CDS 100% 10.800 15.120 N Prpf4b n/a
5 TRCN0000294605 ACTGTCATGAGCACCATTAAT pLKO_005 2984 CDS 100% 15.000 10.500 N Prpf4b n/a
6 TRCN0000294534 TTATCGAGGCTTCCGACAAAG pLKO_005 405 CDS 100% 10.800 7.560 N Prpf4b n/a
7 TRCN0000025359 GCCAATTAAATCACCTTCAAA pLKO.1 1126 CDS 100% 5.625 3.938 N Prpf4b n/a
8 TRCN0000025361 CGGGAGAATGTTGACACCTTT pLKO.1 1943 CDS 100% 4.950 3.465 N Prpf4b n/a
9 TRCN0000025362 GCTGAGCTTGATAATGAGTTA pLKO.1 509 CDS 100% 4.950 3.465 N Prpf4b n/a
10 TRCN0000294603 GCTGAGCTTGATAATGAGTTA pLKO_005 509 CDS 100% 4.950 3.465 N Prpf4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492284 AATCCATTCTCGATCTTGGTCAAC pLX_317 11.2% 88.9% 95.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000477049 GATGGTCCCCGTGCCAATGTATCA pLX_317 12.4% 88.8% 94.7% V5 (many diffs) n/a
3 ccsbBroadEn_07328 pDONR223 100% 88.7% 94.6% None (many diffs) n/a
4 ccsbBroad304_07328 pLX_304 0% 88.7% 94.6% V5 (many diffs) n/a
5 ccsbBroadEn_14919 pDONR223 52.4% 88.6% 23.1% None (many diffs) n/a
6 ccsbBroad304_14919 pLX_304 0% 88.6% 23.1% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000470684 TTAGATAGTCGATTAGTACGTATA pLX_317 12.4% 88.6% 23.1% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_15340 pDONR223 100% 9.8% 10.5% None (many diffs) n/a
9 ccsbBroad304_15340 pLX_304 0% 9.8% 10.5% V5 (many diffs) n/a
10 TRCN0000468046 ACGTATCCAGTATGTTCTCCACTG pLX_317 100% 9.8% 10.5% V5 (many diffs) n/a
11 TRCN0000480281 ATGCACTGTTTCTGCACAACGACC pLX_317 100% 9.8% 10.5% V5 (many diffs) n/a
Download CSV