Transcript: Mouse XM_017315598.1

PREDICTED: Mus musculus death associated protein kinase 1 (Dapk1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dapk1 (69635)
Length:
5128
CDS:
62..4333

Additional Resources:

NCBI RefSeq record:
XM_017315598.1
NBCI Gene record:
Dapk1 (69635)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315598.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322265 AGTTGGCTGCAACGTGAATAT pLKO_005 1501 CDS 100% 13.200 18.480 N Dapk1 n/a
2 TRCN0000350678 CCGCTGTCAACTACGACTTTG pLKO_005 693 CDS 100% 10.800 15.120 N Dapk1 n/a
3 TRCN0000024303 CATGTCTCAAACAAGCTGTTT pLKO.1 2771 CDS 100% 4.950 6.930 N Dapk1 n/a
4 TRCN0000024299 CGGATCAAGATCATAGACTTT pLKO.1 470 CDS 100% 4.950 6.930 N Dapk1 n/a
5 TRCN0000024301 GCTTGATATCACTGTGCCAAA pLKO.1 933 CDS 100% 4.050 2.835 N Dapk1 n/a
6 TRCN0000322199 GCTTGATATCACTGTGCCAAA pLKO_005 933 CDS 100% 4.050 2.835 N Dapk1 n/a
7 TRCN0000024300 CCCTGTGTACTTCTGTTGCTA pLKO.1 2455 CDS 100% 3.000 2.100 N Dapk1 n/a
8 TRCN0000322200 CCCTGTGTACTTCTGTTGCTA pLKO_005 2455 CDS 100% 3.000 2.100 N Dapk1 n/a
9 TRCN0000024302 CCTGATTTCCAGGACAAGGAA pLKO.1 1415 CDS 100% 3.000 1.800 N Dapk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315598.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489780 TATTACATAAACCATTCCCATTTG pLX_317 8.6% 85.7% 92.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_00421 pDONR223 100% 85.6% 92.9% None (many diffs) n/a
3 ccsbBroad304_00421 pLX_304 0% 85.6% 92.9% V5 (many diffs) n/a
4 TRCN0000469687 CCGATACTGTATCGATGCACCAGA pLX_317 9.1% 85.6% 92.9% V5 (many diffs) n/a
5 ccsbBroadEn_14609 pDONR223 38.2% 85.1% 14.2% None (many diffs) n/a
6 ccsbBroad304_14609 pLX_304 0% 85.1% 14.2% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000473889 ACCCGTCACCAACAGAGATTCCCG pLX_317 8.2% 85.1% 14.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV