Transcript: Mouse XM_017317328.1

PREDICTED: Mus musculus protein kinase C, epsilon (Prkce), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prkce (18754)
Length:
6515
CDS:
1040..3121

Additional Resources:

NCBI RefSeq record:
XM_017317328.1
NBCI Gene record:
Prkce (18754)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149211 GCCTTGTCATTTGACAACCG pXPR_003 AGG 1112 53% 9 -0.4439 Prkce PRKCE 76790
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022760 CGGAGTGATCTACAGGGATTT pLKO.1 2617 CDS 100% 10.800 15.120 N Prkce n/a
2 TRCN0000285718 CGGAGTGATCTACAGGGATTT pLKO_005 2617 CDS 100% 10.800 15.120 N Prkce n/a
3 TRCN0000022761 GCTCGGAAACACCCTTATCTA pLKO.1 2426 CDS 100% 5.625 7.875 N Prkce n/a
4 TRCN0000285720 GCTCGGAAACACCCTTATCTA pLKO_005 2426 CDS 100% 5.625 7.875 N Prkce n/a
5 TRCN0000022759 CCCTTATCTAACCCAACTCTA pLKO.1 2437 CDS 100% 4.950 6.930 N Prkce n/a
6 TRCN0000274625 CCCTTATCTAACCCAACTCTA pLKO_005 2437 CDS 100% 4.950 6.930 N Prkce n/a
7 TRCN0000022762 CGTCACTTCGAGGACTGGATT pLKO.1 1370 CDS 100% 4.950 6.930 N Prkce n/a
8 TRCN0000285717 ATTCGGAAGGCCTTGTCATTT pLKO_005 2126 CDS 100% 13.200 10.560 N Prkce n/a
9 TRCN0000323440 GCGATGTCATGAGCTCATTAT pLKO_005 1669 CDS 100% 13.200 9.240 N Prkce n/a
10 TRCN0000374371 GGTCTTGAAGAAGGACGTTAT pLKO_005 2350 CDS 100% 10.800 7.560 N Prkce n/a
11 TRCN0000022763 CGCCATCAAGCAACATCCATT pLKO.1 3019 CDS 100% 4.950 3.465 N Prkce n/a
12 TRCN0000219726 CTGCATGTTCAGGCATATTAT pLKO.1 4892 3UTR 100% 15.000 9.000 N PRKCE n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01283 pDONR223 100% 85.6% 91.7% None (many diffs) n/a
2 ccsbBroad304_01283 pLX_304 27.1% 85.6% 91.7% V5 (many diffs) n/a
3 TRCN0000465452 ACTCTCTGTTATTACCTATAAACG pLX_317 16.2% 85.6% 91.7% V5 (many diffs) n/a
4 TRCN0000488864 CGGTCTTCAACTTCCCTTTTGGCA pLX_317 16.3% 85.6% 91.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489143 GCAGAAAACAATTTGCACCACATC pLX_317 16.3% 85.6% 91.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488382 TGAAGTTGTTGTTCGTTGGTGCGC pLX_317 14.9% 85.6% 91.5% V5 (many diffs) n/a
7 TRCN0000488914 TCCGATTCCCGCTAGAGTGGAAAG pLX_317 14.9% 85.6% 91.5% V5 (many diffs) n/a
8 ccsbBroad304_14790 pLX_304 30.6% 85.3% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_14790 pDONR223 64.8% 85.3% 72.7% None (many diffs) n/a
Download CSV