Transcript: Mouse XM_017318361.1

PREDICTED: Mus musculus X-linked inhibitor of apoptosis (Xiap), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xiap (11798)
Length:
6687
CDS:
517..2007

Additional Resources:

NCBI RefSeq record:
XM_017318361.1
NBCI Gene record:
Xiap (11798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318361.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321203 CCATGTGCTACACCGTCATTA pLKO_005 1958 CDS 100% 13.200 18.480 N Xiap n/a
2 TRCN0000012297 GCTTTAGGTGAAGGCGATAAA pLKO.1 1384 CDS 100% 13.200 18.480 N Xiap n/a
3 TRCN0000012296 GCAATAGATAGATGGCAGTAT pLKO.1 721 CDS 100% 4.950 6.930 N Xiap n/a
4 TRCN0000321136 ACAGCACTGTTTCCGTCTAAA pLKO_005 2126 3UTR 100% 13.200 10.560 N Xiap n/a
5 TRCN0000321202 AGATATTTCAGACACCATATA pLKO_005 957 CDS 100% 13.200 9.240 N Xiap n/a
6 TRCN0000321204 TGGCCGGACTATGCTCATTTA pLKO_005 1033 CDS 100% 13.200 9.240 N Xiap n/a
7 TRCN0000321205 ATCCGGGAGCAGCTATCTATC pLKO_005 1710 CDS 100% 10.800 7.560 N Xiap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318361.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05835 pDONR223 100% 89.8% 89.1% None (many diffs) n/a
2 ccsbBroad304_05835 pLX_304 45.4% 89.8% 89.1% V5 (many diffs) n/a
3 TRCN0000469235 GTCGCCACATCGCTAGCGTAGGTT pLX_317 25.4% 89.8% 89.1% V5 (many diffs) n/a
Download CSV