Transcript: Mouse XM_017321976.1

PREDICTED: Mus musculus fibroblast growth factor receptor 2 (Fgfr2), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fgfr2 (14183)
Length:
5423
CDS:
1304..3721

Additional Resources:

NCBI RefSeq record:
XM_017321976.1
NBCI Gene record:
Fgfr2 (14183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219680 TGGAGTACTCCTATGACATTA pLKO.1 3108 CDS 100% 13.200 18.480 N FGFR2 n/a
2 TRCN0000257217 TGGAGTACTCCTATGACATTA pLKO_005 3108 CDS 100% 13.200 18.480 N FGFR2 n/a
3 TRCN0000321950 TGGAGTACTCCTATGACATTA pLKO_005 3108 CDS 100% 13.200 18.480 N Fgfr2 n/a
4 TRCN0000231052 GCCGTGATCAGTTGGACTAAG pLKO_005 1562 CDS 100% 10.800 15.120 N FGFR2 n/a
5 TRCN0000023717 CCTCTCTACGTCATAGTTGAA pLKO.1 3032 CDS 100% 4.950 6.930 N Fgfr2 n/a
6 TRCN0000023638 CGGGCAAGTAGTCATGGCTGA pLKO.1 2833 CDS 100% 0.720 1.008 N LOC381968 n/a
7 TRCN0000000367 GCCACCAACCAAATACCAAAT pLKO.1 1471 CDS 100% 10.800 8.640 N FGFR2 n/a
8 TRCN0000231053 ATATGGATCAGAGGAGTAAAT pLKO_005 4019 3UTR 100% 13.200 9.240 N FGFR2 n/a
9 TRCN0000321949 ATATGGATCAGAGGAGTAAAT pLKO_005 4019 3UTR 100% 13.200 9.240 N Fgfr2 n/a
10 TRCN0000321970 ATTATCTGGAGATAGCTATTT pLKO_005 2484 CDS 100% 13.200 9.240 N Fgfr2 n/a
11 TRCN0000321906 CATCGCATTGGAGGCTATAAG pLKO_005 1964 CDS 100% 13.200 9.240 N Fgfr2 n/a
12 TRCN0000023716 GCATCGCATTGGAGGCTATAA pLKO.1 1963 CDS 100% 13.200 9.240 N Fgfr2 n/a
13 TRCN0000023715 GCCAGGGATATCAACAACATA pLKO.1 3299 CDS 100% 5.625 3.938 N Fgfr2 n/a
14 TRCN0000194830 CAGTGAAACTTGGTACTTCAT pLKO.1 1702 CDS 100% 4.950 3.465 N FGFR2 n/a
15 TRCN0000000366 GCACACACTTACAGAGCACAA pLKO.1 4262 3UTR 100% 4.050 2.835 N FGFR2 n/a
16 TRCN0000023637 CGAGTATGAGTTGCCAGAGGA pLKO.1 2749 CDS 100% 2.640 1.848 N LOC381968 n/a
17 TRCN0000023718 GCCATCTCATCTGGAGATGAT pLKO.1 1739 CDS 100% 0.495 0.347 N Fgfr2 n/a
18 TRCN0000000369 CCCAACAATAGGACAGTGCTT pLKO.1 1601 CDS 100% 2.640 1.584 N FGFR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488178 TTTGGGGCAGTGGTGCCCTACGGC pLX_317 9.8% 85.4% 90.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489718 CGCCACTACCTCAGAATTGCTGAT pLX_317 16.4% 85.4% 90.6% V5 (many diffs) n/a
3 ccsbBroadEn_14640 pDONR223 0% 85.4% 90.7% None (many diffs) n/a
4 ccsbBroad304_14640 pLX_304 0% 85.4% 90.7% V5 (many diffs) n/a
5 TRCN0000465402 CTAGCGAGATACATAGTTCGCTAC pLX_317 9.6% 85.4% 90.7% V5 (many diffs) n/a
6 TRCN0000491520 TTTCTTCGCCTCATCTCCCTTGTC pLX_317 7.9% 82.8% 87.8% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000492076 ACTGTTTAAGGCTAGTTTATGATC pLX_317 16.5% 82.7% 87.7% V5 (many diffs) n/a
8 TRCN0000491431 CTCACCCCTTCATGGGAGAACTCG pLX_317 12.9% 80% 91.7% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_06211 pDONR223 100% 70.4% 75.5% None (many diffs) n/a
10 ccsbBroad304_06211 pLX_304 0% 70.4% 75.5% V5 (many diffs) n/a
11 TRCN0000487708 AAGTTCAAGTCTTTTTGTAGGCCG pLX_317 15.7% 37.9% 41.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV